From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0177 [new locus tag: SACOL_RS00900 ]
  • pan locus tag?: SAUPAN001034000
  • symbol: murQ
  • pan gene symbol?: murQ
  • synonym:
  • product: N-acetylmuramic acid-6-phosphate etherase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0177 [new locus tag: SACOL_RS00900 ]
  • symbol: murQ
  • product: N-acetylmuramic acid-6-phosphate etherase
  • replicon: chromosome
  • strand: +
  • coordinates: 204259..205158
  • length: 900
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    GTGATGGAAAATAGTACGACCGAAGCGCGTAATGAAGCGACGATGCATCTTGATGAAATG
    ACTGTGGAAGAGGCTTTAATTACGATGAATAAAGAAGATCAGCAAGTCCCGTTAGCAGTT
    CGAAAGGCAATACCACAATTGACAAAAGTAATTAAAAAAACAATTGCACAGTATAAAAAG
    GGTGGACGATTGATTTATATCGGTGCAGGTACAAGTGGAAGGTTGGGTGTCTTAGATGCA
    GCGGAGTGTGTACCTACATTCAATACTGACCCTCATGAAATTATAGGTATTATTGCTGGT
    GGACAACATGCTATGACGATGGCTGTAGAAGGTGCGGAAGATCACAAAAAATTAGCGGAA
    GAAGATTTGAAAAATATAGATTTAACATCAAAAGATGTCGTTATAGGAATTGCCGCGAGT
    GGCAAAACGCCATATGTTATAGGCGGTTTAACATTTGCTAACACAATCGGTGCTACAACA
    GTATCTATTTCATGCAATGAACATGCAGTTATAAGTGAAATTGCGCAGTATCCAGTAGAA
    GTTAAAGTTGGTCCAGAAGTATTAACTGGTTCAACACGTTTAAAGTCTGGTACAGCACAA
    AAGTTAATTTTAAATATGATTTCAACCATCACAATGGTTGGTGTCGGAAAAGTTTACGAT
    AACCTCATGATTGATGTTAAAGCAACCAATCAAAAACTGATCGACCGTTCAGTGCGTATT
    ATTCAAGAAATATGTGCTATCACATATGATGAAGCAATGGCGTTATATCAGGTATCTGAG
    CATGATGTGAAAGTTGCGACAGTTATGGGTATGTGTGGCATTTCTAAGGAAGAAGCAACA
    AGACGGTTATTAAACAATGGTGACATTGTTAAACGAGCAATCAGAGATAGACAACCTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0177 [new locus tag: SACOL_RS00900 ]
  • symbol: MurQ
  • description: N-acetylmuramic acid-6-phosphate etherase
  • length: 299
  • theoretical pI: 6.25943
  • theoretical MW: 32382.3
  • GRAVY: -0.0464883

Function[edit source | edit]

  • reaction:
    EC 4.2.1.126?  ExPASy
    N-acetylmuramic acid 6-phosphate etherase(R)-lactate + N-acetyl-D-glucosamine 6-phosphate = N-acetylmuramate 6-phosphate + H2O
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanN-acetylmuramic acid 6-phosphate etherase (TIGR00274; EC 4.2.1.126; HMM-score: 352.6)
    6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 25.2)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesphosphoheptose isomerase (TIGR00441; EC 5.3.1.28; HMM-score: 21.3)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanglutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 20.3)
    MetabolismCentral intermediary metabolismAmino sugarsglutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 20.3)
    Unknown functionGeneralalpha-NAC homolog (TIGR00264; HMM-score: 14.2)
  • TheSEED:  
    Cell Wall and CapsuleCell Wall and Capsule - no subcategoryRecycling of Peptidoglycan Amino Sugars N-acetylmuramic acid 6-phosphate etherase (EC 4.2.1.126) 
    Cell Wall and Capsule - no subcategoryUDP-N-acetylmuramate from Fructose-6-phosphate Biosynthesis N-acetylmuramic acid 6-phosphate etherase (EC 4.2.1.126) 
  • PFAM:
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 26.3)
    SIS; SIS domain (PF01380; HMM-score: 24.9)
    Beta_propeller (CL0186) RCC1; Regulator of chromosome condensation (RCC1) repeat (PF00415; HMM-score: 14.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.098
    • Ymax_pos: 65
    • Cmax: 0.106
    • Cmax_pos: 26
    • Smax: 0.11
    • Smax_pos: 52
    • Smean: 0.08
    • D: 0.091
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MMENSTTEARNEATMHLDEMTVEEALITMNKEDQQVPLAVRKAIPQLTKVIKKTIAQYKKGGRLIYIGAGTSGRLGVLDAAECVPTFNTDPHEIIGIIAGGQHAMTMAVEGAEDHKKLAEEDLKNIDLTSKDVVIGIAASGKTPYVIGGLTFANTIGATTVSISCNEHAVISEIAQYPVEVKVGPEVLTGSTRLKSGTAQKLILNMISTITMVGVGKVYDNLMIDVKATNQKLIDRSVRIIQEICAITYDEAMALYQVSEHDVKVATVMGMCGISKEEATRRLLNNGDIVKRAIRDRQP

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SACOL0179
    SACOL0179 (TF) important in N-acetylmuramate utilization  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]