From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0379 [new locus tag: SACOL_RS01905 ]
  • pan locus tag?:
  • symbol: SACOL0379
  • pan gene symbol?:
  • synonym:
  • product: prophage L54a, TP901 family tail tape meausure protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0379 [new locus tag: SACOL_RS01905 ]
  • symbol: SACOL0379
  • product: prophage L54a, TP901 family tail tape meausure protein
  • replicon: chromosome
  • strand: +
  • coordinates: 382423..388623
  • length: 6201
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    3601
    3661
    3721
    3781
    3841
    3901
    3961
    4021
    4081
    4141
    4201
    4261
    4321
    4381
    4441
    4501
    4561
    4621
    4681
    4741
    4801
    4861
    4921
    4981
    5041
    5101
    5161
    5221
    5281
    5341
    5401
    5461
    5521
    5581
    5641
    5701
    5761
    5821
    5881
    5941
    6001
    6061
    6121
    6181
    ATGAATGAAAAAGTAGAAGGCATGACCTTGGAGCTGAAATTAGACCATTTAGGTGTCCAA
    GAAGGCATGAAAGGTTTAAAGCGACAATTAGGTGTTGTTAATAGTGAAATGAAAGCTAAT
    CTGTCAGCATTTGATAAGTCTGAAAAATCAATGGAAAAATATCAGGCGAGAATTAAGGGG
    TTAAATGATAGGCTTAAAGTTCAAAAAAAGATGTATTCTCAAGTAGAAGATGAGCTTAAA
    CAAGTTAACGCTAATTACCAAAAAGCTAAATCCAGTGTAAAAGATGTTGAGAAAGCATAT
    TTAAAGTTAGTAGAAGCCAATAAAAAAGAAAAATTAGCTCTTGATAAATCTAAAGAAGCC
    TTAAAATCATCGAATACAGAACTTAAAAAAGCTGAAAATCAATATAAACGTACAAATCAA
    CGTAAACAAGATGCGTATCAAAAACTTAAACAGTTGAGAGATGCAGAACAAAAGCTTAAG
    AATAGTAACCAAGCTACTACTGCACAACTAAAAAGAGCAAGTGACGCAGTACAGAAGCAG
    TCCGCTAAGCATAAAGCACTTGTTGAACAATATAAACAAGAAGGCAATCAAGTTCAAAAA
    CTAAAAGTGCAAAATGACAATCTTTCAAAATCAAATGATAAAATTGAAAGTTCTTACGCT
    AAAACTAATACTAAATTAAAGCAAACAGAAAAAGAATTTAATGATTTAAACAATACTATT
    AAGAATCATAGCGCTAATGTCGCAAAAGCTGAAACAGCTGTTAATAAAGAAAAAGCTGCT
    TTAAATAATTTGGAGCGTTCAATAGATAAAGCTTCATCCGAAATGAAGACTTTTAACAAA
    GAACAAATGATAGCTCAAAGTCATTTCGGTAAACTTGCAAGTCAAGCGGATGTCATGTCA
    AAGAAATTTAGTTCTATTGGAGACAAAATGACTTCCCTGGGACGTACAATGACGATGGGC
    GTATCTACACCAATTACTTTAGGGTTAGGTGCAGCATTAAAAACAAGTGCAGACTTTGAA
    GGCCAAATGTCTCGAGTTGGAGCGATTGCGCAAGCAAGCAGTAAAGACTTGAAAAGCATG
    TCTAATCAAGCAGTTGACTTAGGAGCTAAAACCAGTAAAAGTGCTAACGAAGTTGCTAAA
    GGTATGGAAGAATTGGCAGCTTTAGGCTTTAATGCCAAACAAACAATGGAGGCTATGCCA
    GGTGTTATCAGTGCAGCAGAAGCAAGTGGTGCAGAAATGGCTACAACTGCAACTGTAATG
    GCTTCAGCGATTAACTCTTTCGGTTTAAAAGCATCTGATGCAAATCATGTTGCTGATTTA
    CTTGCGAGATCAGCAAATGATAGTGCTGCAGATATTCAGTACATGGGAGATGCATTGAAG
    TATGCTGGTACTCCTGCAAAAGCATTAGGAGTTTCAATAGAGGACACTTCCGCAGCAATT
    GAAGTTTTATCTAACTCAGGTTTAGAGGGTTCTCAAGCAGGTACTGCCCTAAGAGCTTCA
    TTTATCAGGCTAGCTAATCCAAGTAAAAATACAGCTAAGGAAATGAAAAAATTAGGTATT
    CATTTGTCTGATGCTAAAGGTCAATTTGTTGGCATGGGTGAATTGATTAGACAGTTCCAA
    GATAATATGAAAGGCATGACGAGAGAACAAAAACTAGCTACAGTGGCTACAATAGTTGGT
    ACTGAAGCAGCAAGTGGATTTTTAGCCTTGATTGAAGCGGGACCAGATAAAATTAATAGC
    TATAGTAAATCCTTAAAGAATTCCAATGGCGAAAGTAAAAAAGCAGCAGATTTGATGAAA
    GATAATCTCAAAGGCGCTCTGGAACAATTAGGTGGCGCTTTTGAATCATTAGCAATCGAA
    GTCGGTAAAGATTTAACGCCTATGATTAGAGCAGGAGCGGAAGGTTTAACAAAATTAGTT
    GATGGATTTACACATCTCCCTGGTTGGGTTAGAAAAGCTTCAGTAGGATTAGCACTTTTT
    GGTGCAGCAATTGGACCTGCAGTTCTTGCTGGAGGGTTATTAATACGTACAGTTGGAAGT
    GCTGCTAAAGGATATGCGTCATTAAATAGACGTATTGCTGAAAATACAATCCTTTCAAAT
    ACTAATTCAAAAGCAATGAAATCTTTAGGTCTTCAAACATTATTTCTTGGTTCTACAACA
    GGAAAAACGTCAAAAGGCTTTAAAGGGTTAGCCGGAGCTATGATGTTTAATTTAAAACCT
    ATAAATGTTTTGAAAAATTCTGCAAAGCTAGCAATTTTACCGTTCAAACTTTTGAAAAAC
    GGTTTAGGATTAGCTGCAAAATCTTTATTTGCAGTAAGTGGAGGCGCAAGATTTGCGGGT
    GTAGCCTTAAGGTTTTTAACAGGACCTATAGGTGCTACAATAACTGCTATTACAATTGCG
    TATAAAGTTTTTAAAACCGCATATGATCGTGTGGAATGGTTCAGAAACGGTATTAACGGT
    TTAGGAGAAACTATAAAGTTTTTTGGTGGTAAAATTATTGGCGGCGCTGTTAGAAAGCTA
    GGAGAGTTTAAAAACTATCTTGGAAGTATCGGCAAAAGCTTCAAAGAAAAGTTTTCAAAA
    GATATGAAAGATGGTTATAAATCATTAAGCGACGATGACCTTCTCAAAGTAGGAGTCAAC
    AAGTTTAAAGGATTTATGCAAACCATGGGCACAGCTTCTAAAAAAGCGTCTGATACTGTA
    AAAGTGTTAGGGAAAGGTGTTTCAAAAGAAACAGAAAAAGCTTTAGAAAAATATGTGCAT
    TATTCTGAAGAAAATAGCAGAATCATGGAAAAAGTACGTTTAAACTCGGGTCAGATATCA
    GAAGACAAAGCAAAAAAACTTTTGAAAATTGAAACGGATTTATCTAATAACCTTATAGCT
    GAAATAGAAAAAAGAAATAAAAAGGAACTCGAAAAAACTCAAGAACTTATTGATAAGTAT
    AGTGCATTCGATGAACAAGAAAAGCAAAACATTTTAACTCGAACTAAAGAAAAAAATGAC
    TTGCGAATTAAAAAAGAGCAAGAACTCAATCAGAAAATCAAAGAATTGAAAGAAAAAGCT
    TTGAGTGATGGTCAGATTTCAGAAAATGAAAGAAAAGAAATTGAAAAGCTTGAAAATCAA
    AGACGTGATATCACTGTTAAAGAATTGAGTAAGACTGAAAAAGAGCAAGAGCGTATTTTA
    GTAAGAATGCAAAGAAACAGAAATGCTTATTCAATAGACGAAGCGAGCAAAGCAATTAAA
    GAAGCAGAAAAAGCAAGAAAAGCAAGAAAAAAAGAAGTGGACAAGCAATATGAAGATGAT
    GTCATTGCTATAAAAAATAACGTCAACCTTTCTAAGTCTGAAAAAGATAAATTGTTAGCT
    ATTGCTGATCAAAGACATAAGGATGAAGTAAGAAAGGCAAAATCTAAAAAAGATGCTGTA
    GTAGACGTTGTTAAAAAGCAAAATAAAGATATTGATAAAGAAATGGATTTATCCAGTGGA
    CGTGTATATAAAAATACTGAAAAGTGGTGGAATGGTCTTAAAAGTTGGTGGTCTAACTTT
    AGAGAAGACCAAAAGAAGAAAAGTGATAAATACGCTAAAGAACAAGAAGAAACAGCTCGT
    AGAAACAGAGAAAATATAAAGAAATGGTTTGGAAATGCTTGGGACGGCGTAAAAACTAAA
    ACTGGTGAAGCCTTTAGTAAAATGGGCAGAAATGCTAATCATTTTGGCGGCGAAATGAAA
    AAAATGTGGAGTGGAATCAAAGGAATTCCAAGCAAATTAAGTTCAAGTTGGAGCTCAGCC
    AAAAGTTCTGTAGGATATCACACTAAGGCTATAGCTAATAGTACTGGTAAATGGTTTGGA
    AAAGCTTGGCAATCTGTTAAATCGACAACAGGAAGTATTTACAATCAAACTAAGCAAAAG
    TATTCAGATGCCTCAGATAAAGCTTGGGCGCATTCAAAATCTATTTGGAAAGGGACATCA
    AAATGGTTTAGCAATGCATATAAAAGTGCAAAGGGCTGGCTAACGGATATGGCTAATAAA
    TCGCGCTCGAAATGGGATAATATTTCTAGTACAGCATGGTCGAATGCAAAATCCGTTTGG
    AAAGGCACATCGAAATGGTTTGGTAACTCATACAAATCTTTAAAAGGTTGGACTGGGGAT
    ATGTATTCAAGAGCCCACGATCGTTTTGATGCAATTTCAAGTTCGGCATGGTCTAACGCT
    AAATCAGTATTTAATGGTTTTAGAAAATGGCTATCAAAAACATATGATTGGATTAGAGAT
    ATTGGTAAAGACATGGGAAGAGCTGCGGCTGATTTAGGTAAAAATGTTGCTAATAAAGCT
    ATTGGCGGTTTGAATAGCATGATTGGCGGTATTAATAAAATATCTAAAGCCATTACTGAT
    AAAAATCTCATCAAGCCAATACCTACATTGTCTACTGGTACTTTAGCAGGAAAGGGTGTA
    GCTACCGATAATTCGGGAGCATTAACGCAACCGACATTTGCTGTATTAAATGATAGAGGT
    TCTGGAAACGCTCCAGGCGGTGGAGTTCAAGAAGTAATTCACAGGGCTGACGGAACATTC
    CATGCACCCCAAGGACGAGATGTGGTTGTTCCACTAGGAGTTGGAGATAGTGTAATAAAT
    GCCAATGACACTCTGAAGTTACAGCGGATGGGTGTTTTGCCAAAATTCCATGGTGGTACG
    AAAAAGAAAAAATGGATGGAACAAGTTACTGAAAATCTTGGTAAAAAAGCAGGGGACTTC
    GGTTCTAAAGCTAAAAACACAGCTCATAATATCAAAAAAGGTGCAGAAGAAATGGTTGAA
    GCCGCAGGCGATAAAATCAAAGATGGTGCATCTTGGTTAGGCGATAAAATCGGCGATGTG
    TGGGATTATGTACAACATCCAGGGAAACTAGTAAATAAAGTAATGTCAGGTTTAAATATT
    AATTTTGGAGGCGGAGCTAACGCTACAGTAAAAATTGCTAAAGGCGCGTACTCATTGCTC
    AAAAAGAAATTAGTAGACAAAGTAAAATCGTGGTTTGAAGATTTTGGTGGCGGAGGCGAT
    GGAAGCTATCTATTTGACCATCCAATTTGGCAAAGGTTTGGGAGTTACACAGGTGGACTT
    AACTTTAATGGCGGTCGTCACTATGGTATCGACTTTGGTATGCCTACAGGAACGAACATT
    TATGCTGTTAAAGGCGGTATAGCTGATAAAGTATGGACTGATTACGGTGGCGGTAATTCT
    ATACAAATTAAGACCGGTGCTAACGAATGGAACTGGTATATGCATTTATCTAAGCAATTA
    GCAAGACAAGGCCAACGTATTAAAGCTGGTCAACTGATAGGGAAATCAGGTGCTACAGGT
    AATTTCGTTAGAGGAGCACACTTACATTTCCAATTGATGCAAGGGTCGCATCCAGGGAAT
    GATACAGCTAAAGATCCAGAAAAATGGTTGAAGTCACTTAAAGGTAGTGGCGTTCGAAGT
    GGTTCAGGTGTTAATAAGGCTGCATCTGCTTGGGCAGGCGATATACGTCGTGCAGCAAAA
    CGAATGGGGGTTAATGTTACTTCGGGTGACGTAGGAAATATCATTAGCTTGATTCAACAC
    GAATCAGGAGGAAATGCAGGTATAACTCAATCTAGTTCGCTTAGAGACATCAACGTTTTA
    CAGGGCAATCCAGCAAAAGGATTGCTTCAATATATCCCACAAACATTTAGACATTATGCT
    GTTAGAGGTCACAACAATATATATAGTGGTTACGATCAGTTATTAGCGTTCTTTAACAAC
    AGATATTGGCGCTCACAGTTTAACCCAAGAGGTGGTTGGTCTCCAAGTGGTCCAAGAAGA
    TATGCGAATGGTGGTTTGATTACAAAGCATCAACTTGCTGAAGTGGGTGAAGGAGATAAA
    CAGGAGATGGTTATCCCTTTAACTAGACGTAAACGAGCAATTCAATTAACTGAACAGGTT
    ATGCGCATCATCGGTATGGATGGCAAGCCAAATAACATCACTGTAAATAATGATACTTCA
    ACAGTTGAAAAATTGTTGAAACAAATTGTTATGTTAAGTGATAAAGGAAATAAATTAACA
    GATGCATTGATTCAAACTGTTTCTTCTCAGGATAATAACTTAGGTTCTAATGATGCAATT
    AGAGGTTTAGAAAAAATATTGTCAAAACAAAGTGGGCATAGAGCAAATGCAAATAATTAT
    ATGGGAGGTTTGACTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3600
    3660
    3720
    3780
    3840
    3900
    3960
    4020
    4080
    4140
    4200
    4260
    4320
    4380
    4440
    4500
    4560
    4620
    4680
    4740
    4800
    4860
    4920
    4980
    5040
    5100
    5160
    5220
    5280
    5340
    5400
    5460
    5520
    5580
    5640
    5700
    5760
    5820
    5880
    5940
    6000
    6060
    6120
    6180
    6201

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0379 [new locus tag: SACOL_RS01905 ]
  • symbol: SACOL0379
  • description: prophage L54a, TP901 family tail tape meausure protein
  • length: 2066
  • theoretical pI: 10.5037
  • theoretical MW: 226040
  • GRAVY: -0.61181

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage tail tape measure protein, TP901 family, core region (TIGR01760; HMM-score: 367.5)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 49.5)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 49.5)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 41.7)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 41.7)
  • TheSEED:  
    Phages, Prophages, Transposable elements, PlasmidsPhages, ProphagesPhage tail proteins 2 Phage tail length tape-measure protein 
  • PFAM:
    no clan definedPhageMin_Tail; Phage-related minor tail protein (PF10145; HMM-score: 162.3)
    Hybrid (CL0105) Peptidase_M23; Peptidase family M23 (PF01551; HMM-score: 75)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.02
    • Extracellular Score: 9.98
    • Internal Helices: 2
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.114
    • Ymax_pos: 51
    • Cmax: 0.115
    • Cmax_pos: 51
    • Smax: 0.17
    • Smax_pos: 2
    • Smean: 0.109
    • D: 0.112
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNEKVEGMTLELKLDHLGVQEGMKGLKRQLGVVNSEMKANLSAFDKSEKSMEKYQARIKGLNDRLKVQKKMYSQVEDELKQVNANYQKAKSSVKDVEKAYLKLVEANKKEKLALDKSKEALKSSNTELKKAENQYKRTNQRKQDAYQKLKQLRDAEQKLKNSNQATTAQLKRASDAVQKQSAKHKALVEQYKQEGNQVQKLKVQNDNLSKSNDKIESSYAKTNTKLKQTEKEFNDLNNTIKNHSANVAKAETAVNKEKAALNNLERSIDKASSEMKTFNKEQMIAQSHFGKLASQADVMSKKFSSIGDKMTSLGRTMTMGVSTPITLGLGAALKTSADFEGQMSRVGAIAQASSKDLKSMSNQAVDLGAKTSKSANEVAKGMEELAALGFNAKQTMEAMPGVISAAEASGAEMATTATVMASAINSFGLKASDANHVADLLARSANDSAADIQYMGDALKYAGTPAKALGVSIEDTSAAIEVLSNSGLEGSQAGTALRASFIRLANPSKNTAKEMKKLGIHLSDAKGQFVGMGELIRQFQDNMKGMTREQKLATVATIVGTEAASGFLALIEAGPDKINSYSKSLKNSNGESKKAADLMKDNLKGALEQLGGAFESLAIEVGKDLTPMIRAGAEGLTKLVDGFTHLPGWVRKASVGLALFGAAIGPAVLAGGLLIRTVGSAAKGYASLNRRIAENTILSNTNSKAMKSLGLQTLFLGSTTGKTSKGFKGLAGAMMFNLKPINVLKNSAKLAILPFKLLKNGLGLAAKSLFAVSGGARFAGVALRFLTGPIGATITAITIAYKVFKTAYDRVEWFRNGINGLGETIKFFGGKIIGGAVRKLGEFKNYLGSIGKSFKEKFSKDMKDGYKSLSDDDLLKVGVNKFKGFMQTMGTASKKASDTVKVLGKGVSKETEKALEKYVHYSEENSRIMEKVRLNSGQISEDKAKKLLKIETDLSNNLIAEIEKRNKKELEKTQELIDKYSAFDEQEKQNILTRTKEKNDLRIKKEQELNQKIKELKEKALSDGQISENERKEIEKLENQRRDITVKELSKTEKEQERILVRMQRNRNAYSIDEASKAIKEAEKARKARKKEVDKQYEDDVIAIKNNVNLSKSEKDKLLAIADQRHKDEVRKAKSKKDAVVDVVKKQNKDIDKEMDLSSGRVYKNTEKWWNGLKSWWSNFREDQKKKSDKYAKEQEETARRNRENIKKWFGNAWDGVKTKTGEAFSKMGRNANHFGGEMKKMWSGIKGIPSKLSSSWSSAKSSVGYHTKAIANSTGKWFGKAWQSVKSTTGSIYNQTKQKYSDASDKAWAHSKSIWKGTSKWFSNAYKSAKGWLTDMANKSRSKWDNISSTAWSNAKSVWKGTSKWFGNSYKSLKGWTGDMYSRAHDRFDAISSSAWSNAKSVFNGFRKWLSKTYDWIRDIGKDMGRAAADLGKNVANKAIGGLNSMIGGINKISKAITDKNLIKPIPTLSTGTLAGKGVATDNSGALTQPTFAVLNDRGSGNAPGGGVQEVIHRADGTFHAPQGRDVVVPLGVGDSVINANDTLKLQRMGVLPKFHGGTKKKKWMEQVTENLGKKAGDFGSKAKNTAHNIKKGAEEMVEAAGDKIKDGASWLGDKIGDVWDYVQHPGKLVNKVMSGLNINFGGGANATVKIAKGAYSLLKKKLVDKVKSWFEDFGGGGDGSYLFDHPIWQRFGSYTGGLNFNGGRHYGIDFGMPTGTNIYAVKGGIADKVWTDYGGGNSIQIKTGANEWNWYMHLSKQLARQGQRIKAGQLIGKSGATGNFVRGAHLHFQLMQGSHPGNDTAKDPEKWLKSLKGSGVRSGSGVNKAASAWAGDIRRAAKRMGVNVTSGDVGNIISLIQHESGGNAGITQSSSLRDINVLQGNPAKGLLQYIPQTFRHYAVRGHNNIYSGYDQLLAFFNNRYWRSQFNPRGGWSPSGPRRYANGGLITKHQLAEVGEGDKQEMVIPLTRRKRAIQLTEQVMRIIGMDGKPNNITVNNDTSTVEKLLKQIVMLSDKGNKLTDALIQTVSSQDNNLGSNDAIRGLEKILSKQSGHRANANNYMGGLTN

Experimental data[edit source | edit]

  • experimental localization: Cytoplasmic [1]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]