From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1241 [new locus tag: SACOL_RS06345 ]
  • pan locus tag?: SAUPAN003511000
  • symbol: recG
  • pan gene symbol?: recG
  • synonym:
  • product: ATP-dependent DNA helicase RecG

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1241 [new locus tag: SACOL_RS06345 ]
  • symbol: recG
  • product: ATP-dependent DNA helicase RecG
  • replicon: chromosome
  • strand: +
  • coordinates: 1249596..1251656
  • length: 2061
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    TTGGCTAAAGTAAACTTAATAGAAAGTCCATATTCTCTTTTACAATTAAAAGGTATAGGT
    CCTAAGAAAATAGAAGTATTGCAACAACTAAATATTCATACAGTGGAAGATCTTGTTCTT
    TATTTGCCAACTAGATATGAAGATAATACAGTGATTGATTTGAATCAAGCAGAAGATCAA
    TCTAACGTTACGATAGAAGGACAAGTATATACAGCTCCAGTAGTTGCATTTTTTGGAAGA
    AATAAATCAAAATTAACCGTTCATTTAATGGTAAATAATATTGCTGTCAAATGTATTTTT
    TTCAATCAACCGTATTTAAAAAAGAAAATCGAATTAAATCAAACTATAACTGTTAAAGGT
    AAGTGGAATAGGGTTAAACAGGAAATTACTGGTAATAGGGTTTTCTTTAATTCACAAGGG
    ACACAAACTCAAGAAAACGCAGATGTTCAATTAGAACCAGTCTATCGTATTAAGGAAGGT
    ATTAAACAAAAGCAAATACGAGACCAAATTAGACAAGCGTTAAATGATGTGACAATTCAT
    GAATGGTTAACTGATGAACTAAGAGAAAAATATAAATTAGAGACCTTGGACTTTACTTTG
    AACACATTACATCATCCTAAAAGTAAAGAGGATTTATTACGTGCTCGTAGAACCTATGCA
    TTTACTGAACTGTTTTTATTCGAATTACGTATGCAATGGCTAAATAGATTAGAAAAGTCA
    TCTGACGAAGCAATTGAAATTGATTATGACATAGACCAAGTTAAATCATTTATTGATCGT
    TTACCTTTTGAACTAACTGAAGCACAGAAATCCAGTGTTAATGAAATTTTTAGAGATTTA
    AAAGCACCAATACGTATGCATCGATTACTTCAAGGTGATGTAGGTTCAGGAAAAACAGTA
    GTTGCTGCAATTTGTATGTATGCGTTAAAAACTGCTGGTTATCAATCAGCATTGATGGTA
    CCAACTGAAATTTTAGCAGAGCAACATGCTGAAAGTTTAATGGCTTTATTTGGAGATTCT
    ATGAACGTTGCATTGTTAACTGGGTCAGTAAAAGGTAAGAAACGAAAGATACTTTTAGAA
    CAACTTGAAAATGGTACGATTGATTGTTTAATTGGAACCCATGCTTTGATTCAAGATGAT
    GTGATTTTCCATAATGTTGGTTTAGTAATTACAGATGAACAACATCGATTTGGTGTGAAT
    CAACGCCAGCTTTTAAGAGAAAAAGGTGCAATGACGAATGTGTTATTTATGACAGCAACG
    CCGATACCAAGAACACTAGCAATATCAGTTTTTGGTGAGATGGATGTGTCTTCAATTAAA
    CAATTACCAAAAGGTCGTAAACCTATCATTACTACTTGGGCAAAGCATGAGCAATACGAT
    AAAGTTTTGATGCAAATGACCTCAGAGTTGAAAAAAGGTCGTCAAGCATATGTCATTTGC
    CCGCTAATAGAAAGTTCTGAGCATCTCGAAGATGTTCAAAATGTTGTCGCATTGTACGAG
    TCTTTACAACAGTATTATGGTGTTTCCCGTGTAGGGTTATTGCATGGTAAGTTATCTGCC
    GATGAAAAAGATGAGGTCATGCAAAAGTTTAGTAATCATGAGATAAATGTTTTAGTTTCT
    ACTACTGTTGTTGAAGTAGGTGTTAATGTACCGAATGCAACTTTTATGATGATTTATGAT
    GCGGATCGCTTTGGATTATCAACTTTACATCAGTTACGCGGTCGTGTAGGTAGAAGTGAC
    CAGCAAAGTTACTGTGTTTTAATTGCATCCCCTAAAACAGAAACAGGAATTGAAAGAATG
    ACAATTATGACACAAACAACGGATGGATTTGAATTGAGTGAACGAGACTTAGAAATGCGT
    GGTCCTGGAGATTTCTTTGGTGTTAAACAAAGTGGATTGCCAGATTTCTTAGTTGCCAAT
    TTAGTTGAAGATTATCGTATGTTAGAAGTTGCTCGTGATGAAGCAGCTGAACTTATTCAA
    TCTGGCGTATTCTTTGAAAATACGTATCAACATTTACGTCATTTTGTTGAAGAAAATTTA
    TTACATCGTAGTTTTGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2061

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1241 [new locus tag: SACOL_RS06345 ]
  • symbol: RecG
  • description: ATP-dependent DNA helicase RecG
  • length: 686
  • theoretical pI: 6.25283
  • theoretical MW: 78342.4
  • GRAVY: -0.268805

Function[edit source | edit]

  • reaction:
    EC 3.6.4.12?  ExPASy
    DNA helicaseATP + H2O = ADP + phosphate
    EC 3.6.1.-?  ExPASy
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecG (TIGR00643; EC 3.6.4.12; HMM-score: 751.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscription-repair coupling factor (TIGR00580; EC 3.6.1.-; HMM-score: 354)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprimosomal protein N' (TIGR00595; EC 3.6.1.-; HMM-score: 56.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairreverse gyrase (TIGR01054; EC 3.6.4.12,5.99.1.3; HMM-score: 43.8)
    CRISPR-associated helicase Cas3 (TIGR01587; HMM-score: 41.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase, RecQ family (TIGR00614; EC 3.6.4.12; HMM-score: 39)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit B (TIGR00631; EC 3.1.25.-; HMM-score: 35.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecQ (TIGR01389; EC 3.6.4.12; HMM-score: 29.3)
    DNA phosphorothioation system restriction enzyme (TIGR04095; HMM-score: 25.9)
    DEXH box helicase, DNA ligase-associated (TIGR04121; EC 3.6.4.-; HMM-score: 21.7)
    helicase/secretion neighborhood putative DEAH-box helicase (TIGR03817; HMM-score: 16.7)
    putative RecB family nuclease, TM0106 family (TIGR03491; HMM-score: 14.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 14.2)
  • TheSEED:  
    DNA MetabolismDNA replicationDNA-replication ATP-dependent DNA helicase RecG (EC 3.6.1.-) 
    RNA MetabolismTranscriptionTranscription factors bacterial ATP-dependent DNA helicase RecG (EC 3.6.1.-) 
    A Gram-positive cluster that relates ribosomal protein L28P to a set of uncharacterized proteins ATP-dependent DNA helicase RecG (EC 3.6.1.-) 
  • PFAM:
    P-loop_NTPase (CL0023) Helicase_C; Helicase conserved C-terminal domain (PF00271; HMM-score: 87.4)
    OB (CL0021) RecG_wedge; RecG wedge domain (PF17191; HMM-score: 71.3)
    P-loop_NTPase (CL0023) DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 62.6)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 45.6)
    AAA_30; AAA domain (PF13604; HMM-score: 17.9)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.134
    • Ymax_pos: 28
    • Cmax: 0.114
    • Cmax_pos: 48
    • Smax: 0.248
    • Smax_pos: 21
    • Smean: 0.158
    • D: 0.144
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAKVNLIESPYSLLQLKGIGPKKIEVLQQLNIHTVEDLVLYLPTRYEDNTVIDLNQAEDQSNVTIEGQVYTAPVVAFFGRNKSKLTVHLMVNNIAVKCIFFNQPYLKKKIELNQTITVKGKWNRVKQEITGNRVFFNSQGTQTQENADVQLEPVYRIKEGIKQKQIRDQIRQALNDVTIHEWLTDELREKYKLETLDFTLNTLHHPKSKEDLLRARRTYAFTELFLFELRMQWLNRLEKSSDEAIEIDYDIDQVKSFIDRLPFELTEAQKSSVNEIFRDLKAPIRMHRLLQGDVGSGKTVVAAICMYALKTAGYQSALMVPTEILAEQHAESLMALFGDSMNVALLTGSVKGKKRKILLEQLENGTIDCLIGTHALIQDDVIFHNVGLVITDEQHRFGVNQRQLLREKGAMTNVLFMTATPIPRTLAISVFGEMDVSSIKQLPKGRKPIITTWAKHEQYDKVLMQMTSELKKGRQAYVICPLIESSEHLEDVQNVVALYESLQQYYGVSRVGLLHGKLSADEKDEVMQKFSNHEINVLVSTTVVEVGVNVPNATFMMIYDADRFGLSTLHQLRGRVGRSDQQSYCVLIASPKTETGIERMTIMTQTTDGFELSERDLEMRGPGDFFGVKQSGLPDFLVANLVEDYRMLEVARDEAAELIQSGVFFENTYQHLRHFVEENLLHRSFD

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]