From AureoWiki
NCBI: 10-JUN-2013
Contents
⊟Summary[edit source | edit]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1334 [new locus tag: SACOL_RS06790 ]
- pan locus tag?: SAUPAN003634000
- symbol: SACOL1334
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit source | edit]
⊟Gene[edit source | edit]
⊟General[edit source | edit]
- type: CDS
- locus tag: SACOL1334 [new locus tag: SACOL_RS06790 ]
- symbol: SACOL1334
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1350726..1350836
- length: 111
- essential: unknown other strains
⊟Accession numbers[edit source | edit]
- Gene ID: 3237894 NCBI
- RefSeq: YP_186188 NCBI
- MicrobesOnline: 912794 MicrobesOnline
⊟Phenotype[edit source | edit]
- Share your knowledge and add information here. [edit]
⊟DNA sequence[edit source | edit]
- 1
61ATGAAGATGACTATTAAAGTGCGAAAAACAAATAAAAAAGAGAAAATAGAATTTTTAATA
GGGACGTTTATAATTATTTTAGTAATATTAGGGTTCAAAATTATGAAATAA60
111
⊟Protein[edit source | edit]
⊟General[edit source | edit]
- locus tag: SACOL1334 [new locus tag: SACOL_RS06790 ]
- symbol: SACOL1334
- description: hypothetical protein
- length: 36
- theoretical pI: 11.262
- theoretical MW: 4267.46
- GRAVY: 0.577778
⊟Function[edit source | edit]
- reaction:
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & interactions[edit source | edit]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
⊟Localization[edit source | edit]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helix: 1
- LocateP: N-terminally anchored (No CS)
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular Possibility: 0.17
- Signal Peptide Possibility: -1
- N-terminally Anchored Score: 4
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- Ymax: 0.156
- Ymax_pos: 11
- Cmax: 0.102
- Cmax_pos: 15
- Smax: 0.312
- Smax_pos: 2
- Smean: 0.243
- D: 0.19
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit source | edit]
⊟Protein sequence[edit source | edit]
- MKMTIKVRKTNKKEKIEFLIGTFIIILVILGFKIMK
⊟Experimental data[edit source | edit]
- experimentally validated: no data available
⊟Expression & Regulation[edit source | edit]
⊟Operon[edit source | edit]
- MicrobesOnline: SACOL1334 no polycistronic organisation predicted
⊟Regulation[edit source | edit]
- sigma factor:
- regulator:
⊟Transcription pattern[edit source | edit]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit source | edit]
- Aureolib: no data available
⊟Protein stability[edit source | edit]
- half-life: no data available
⊟Biological Material[edit source | edit]
⊟Mutants[edit source | edit]
⊟Expression vector[edit source | edit]
⊟lacZ fusion[edit source | edit]
⊟GFP fusion[edit source | edit]
⊟two-hybrid system[edit source | edit]
⊟FLAG-tag construct[edit source | edit]
⊟Antibody[edit source | edit]
⊟Other Information[edit source | edit]
You are kindly invited to share additional interesting facts.
