NCBI: 10-JUN-2013

⊟Summary

• organism: Staphylococcus aureus COL
• locus tag: SACOL1334 [new locus tag: SACOL_RS06790 ]
• pan locus tag^?: SAUPAN003634000
• symbol: SACOL1334
• pan gene symbol^?: —
• synonym:
• product: hypothetical protein

⊟Gene

⊟General

• type: CDS
• locus tag: SACOL1334 [new locus tag: SACOL_RS06790 ]
• symbol: SACOL1334
• product: hypothetical protein
• replicon: chromosome
• strand: +
• coordinates: 1350726..1350836
• length: 111
• essential: unknown other strains

⊟Accession numbers

• Gene ID: 3237894 NCBI
• RefSeq: YP_186188 NCBI
• BioCyc:
• MicrobesOnline: 912794 MicrobesOnline

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  
  ATGAAGATGACTATTAAAGTGCGAAAAACAAATAAAAAAGAGAAAATAGAATTTTTAATA
  GGGACGTTTATAATTATTTTAGTAATATTAGGGTTCAAAATTATGAAATAA
  60
  111
  

⊟Protein

⊟General

• locus tag: SACOL1334 [new locus tag: SACOL_RS06790 ]
• symbol: SACOL1334
• description: hypothetical protein
• length: 36
• theoretical pI: 11.262
• theoretical MW: 4267.46
• GRAVY: 0.577778

⊟Function

• TIGRFAM:
• TheSEED:
• PFAM:

⊟Structure, modifications & interactions

• domains:
• modifications:
• cofactors:
• effectors:
• protein partners:

⊟Localization

• PSORTb: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.32
  • Cytoplasmic Membrane Score: 9.55
  • Cellwall Score: 0.12
  • Extracellular Score: 0.01
  • Internal Helix: 1
• LocateP: N-terminally anchored (No CS)
  • Prediction by SwissProt Classification: Membrane
  • Pathway Prediction: Sec-(SPI)
  • Intracellular Possibility: 0.17
  • Signal Peptide Possibility: -1
  • N-terminally Anchored Score: 4
  • Predicted Cleavage Site: No CleavageSite
• SignalP: no predicted signal peptide
  • Ymax: 0.156
  • Ymax_pos: 11
  • Cmax: 0.102
  • Cmax_pos: 15
  • Smax: 0.312
  • Smax_pos: 2
  • Smean: 0.243
  • D: 0.19
• predicted transmembrane helices (TMHMM): 1

⊟Accession numbers

• GI: 57650304 NCBI
• RefSeq: YP_186188 NCBI
• UniProt: A0A0H2WWZ9 UniProt

⊟Protein sequence

• MKMTIKVRKTNKKEKIEFLIGTFIIILVILGFKIMK

⊟Experimental data

• experimentally validated: no data available

⊟Expression & Regulation

⊟Operon

• MicrobesOnline: SACOL1334 no polycistronic organisation predicted

⊟Regulation

• sigma factor:
• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Other Information

You are kindly invited to share additional interesting facts.