From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS14340
  • pan locus tag?:
  • symbol: ssrA
  • pan gene symbol?:
  • synonym:
  • product: transfer-messenger RNA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: tmRNA
  • locus tag: SACOL_RS14340
  • symbol: ssrA
  • product: transfer-messenger RNA
  • replicon: chromosome
  • strand: +
  • coordinates: 875955..876316
  • length: 362
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (875955..876316) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    GGGGACGTTCATGGATTCGACAGGGGTCCCCCGAGCTCATTAAGCGTGTCGGAGGGTTGT
    CTTCGTCATCAACACACACAGTTTATAATAACTGGCAAATCAAACAATAATTTCGCAGTA
    GCTGCCTAATCGCACTCTGCATCGCCTAACAGCATTTCCTATGTGCTGTTAACGCGATTC
    AACCTTAATAGGATATGCTAAACACTGCCGTTTGAAGTCTGTTTAGAAGAAACTTAATCA
    AACTAGCATCATGTTGGTTGTTTATCACTTTTCATGATGCGAAACCTATCGATAAACTAC
    ACACGTAGAAAGATGTGTATCAGGACCTTTGGACGCGGGTTCAAATCCCGCCGTCTCCAT
    AT
    60
    120
    180
    240
    300
    360
    362

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS14340
  • symbol: SsrA
  • description: transfer-messenger RNA
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit source | edit]

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • ssrA no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]