From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
UniProt: 18-JAN-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00411.4
  • pan locus tag?: SAUPAN002162000
  • symbol: psmα1
  • pan gene symbol?:
  • synonym: psmA1
  • product: Phenol-soluble modulin alpha 1 peptide

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00411.4
  • symbol: psmα1
  • product: Phenol-soluble modulin alpha 1 peptide
  • replicon: chromosome
  • strand: -
  • coordinates: 412926..412991
  • length: 66
  • essential: unknown

Accession numbers[edit source | edit]

  • Gene ID:
  • RefSeq:
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    ATGGGTATCATCGCTGGCATCATTAAAGTTATCAAAAGCTTAATCGAACAATTCACTGGT
    AAATAA
    60
    66

Protein[edit source | edit]

Protein Data Bank: 5KHB

General[edit source | edit]

  • locus tag: SAOUHSC_00411.4
  • symbol: Psmα1
  • description: Phenol-soluble modulin alpha 1 peptide
  • length: 21
  • theoretical pI: 10.5069
  • theoretical MW: 2259.81
  • GRAVY: 0.957143

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan definedPsm4; Phenol-soluble modulin alpha 4 peptide (PF17063; HMM-score: 17.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.088
    • Ymax_pos: 21
    • Cmax: 0.102
    • Cmax_pos: 21
    • Smax: 0.106
    • Smax_pos: 1
    • Smean: 0.077
    • D: 0.084
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGIIAGIIKVIKSLIEQFTGK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • psmα1 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat. Med.: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Chikara Kaito, Yuki Saito, Gentaro Nagano, Mariko Ikuo, Yosuke Omae, Yuichi Hanada, Xiao Han, Kyoko Kuwahara-Arai, Tomomi Hishinuma, Tadashi Baba, Teruyo Ito, Keiichi Hiramatsu, Kazuhisa Sekimizu
Transcription and translation products of the cytolysin gene psm-mec on the mobile genetic element SCCmec regulate Staphylococcus aureus virulence.
PLoS Pathog.: 2011, 7(2);e1001267
[PubMed:21304931] [WorldCat.org] [DOI] (I e)