From AureoWiki
(Redirected from SAOUHSC 01139)
Jump to: navigation, search
UniProt: 10-MAY-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01139/SAOUHSC_01141
  • pan locus tag?: SAUPAN003446000
  • symbol: bshC
  • pan gene symbol?: bshC
  • synonym:
  • product: Putative cysteine ligase BshC

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: pseudogene
  • locus tag: SAOUHSC_01139/SAOUHSC_01141
  • symbol: bshC
  • product: Putative cysteine ligase BshC
  • replicon: chromosome
  • strand: +
  • coordinates: 1090331..1091952
  • length: 1622
  • essential: no DEG other strains
  • comment: truncated BshC-protein because of 8 bp-duplication [1]

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGGACTGTAAAGTAGTTAGTTTAAATGAAAAAGATCAGTTTATACCAAAAATAAAGAGC
    AGTGACCCTGTAATAACAGGATTATTTCAATATGATGCAGCTCAACAAACTAGTTTTGAA
    AAAAGGATGTCTAAAGAAAATAATGGAAGAGAAGCGGCATTAGCGAATGTTATTCGTGAA
    TATATGAGTGATTTAAAGCTTTCAAGCTTTCAAGTGAACAAGAATTAAACATACAACATT
    TAGCTAATGGTTCAAAAGTTGTGATTGGTGGACAACAAGCAGGGCTTTTCGGGGGACCAT
    TGTATACATTCCATAAAATATTTTCAATCATTACTTTATCTAAGGAATTAACGGATACAC
    ATAAGCAACAAGTAGTACCAGTTTTTTGGATTGCAGGAGAAGATCATGATTTCGATGAAG
    TGAATCATACATTTGTTTATAACGAAAATCATGGGTCGCTGCATAAGGTTAAATATCATA
    CAATGGAGATGCCAGAGACGACTGTCTCTAGATATTATCCTGATAAGGCTGAGTTGAAAC
    AAACTTTAAAAACGATGTTCATTCATATGAAAGAAACTGTTCATACACAAGGTCTACTGG
    AGATTTGTGACAGAATTATTGACCAATATGACTCGTGGACTGATATGTTTAAAGCACTAC
    TGCATGAAACATTTAAAGCATATGGCGTTCTATTTATAGATGCGCAGTTTGAGCCGTTAA
    GAAAAATGGAAGCGCCTATGTTTAAAAAGATTTTGAAAAAACATCAGTTGCTTGATGATG
    CTTTTAGAGCAACACAACAACGTACTCAAAATCAAGGCTTGAATGCGATGATACAAACAG
    ATACAAATGTTCATTTATTCTTACATGATGAAAATATGCGTCAATTAGTTTCGTATGATG
    GTAAGCATTTTAAATTAAATAAAACAGATAAGACATATATAAAGGAAGAAATTATAAATA
    TTGCGGAAAATCAACCTGAATTATTTTCTAATAATGTAGTGACAAGACCATTAATGGAAG
    AATGGTTATTTAACACGGTGGCATTTGTTGGAGGACCGAGTGAAATTAAGTACTGGGCTG
    AACTAAAAGATGTATTTGAACTATTTGATGTTGAAATGCCTATCGTGATGCCAAGGCTTA
    GAATTACTTATTTAAATGACCGTATAGAAAAATTACTTTCGAAATACAATATTCCATTAG
    AAAAAGTGTTAGTCGATGGTGTTGAAGGAGAAAGAAGTAAGTTTATTAGAGAACAAGCAT
    CACATCAATTTATTGAAAAGGTAGAAGGTATGATTGAACAACAGCGTCGTCTAAACAAAG
    ACTTATTAGATGAAGTGGCGGGGAATCAAAATAATATTAACCTTGTGAATAAAAATAATG
    AAATTCATATACAACAGTATGATTATTTGTTAAAACGTTATCTTTTAAACATTGAAAGAG
    AAAACGACATCAGTATGAAGCAATTTAGAGAAATTCAAGAAACACTCCATCCAATGGGAG
    GATTACAAGAAAGAATATGGAATCCACTTCAAATTTTGAATGATTTTGGGACAGATGTGT
    TCAAGCCCTCCACCTATCCACCACTTTCTTACACTTTTGATCATATTATTATAAAACCTT
    AA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1622

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01139/SAOUHSC_01141
  • symbol: BshC
  • description: Putative cysteine ligase BshC
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit source | edit]

  • reaction:
    EC 6.-.-.-?  ExPASy
  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt: Q2FZ98 UniProt

Protein sequence[edit source | edit]

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • bshC no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dierk-Christoph Pöther, Philipp Gierok, Manuela Harms, Jörg Mostertz, Falko Hochgräfe, Haike Antelmann, Chris J Hamilton, Ilya Borovok, Michael Lalk, Yair Aharonowitz, Michael Hecker
    Distribution and infection-related functions of bacillithiol in Staphylococcus aureus.
    Int. J. Med. Microbiol.: 2013, 303(3);114-23
    [PubMed:23517692] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

Dierk-Christoph Pöther, Philipp Gierok, Manuela Harms, Jörg Mostertz, Falko Hochgräfe, Haike Antelmann, Chris J Hamilton, Ilya Borovok, Michael Lalk, Yair Aharonowitz, Michael Hecker
Distribution and infection-related functions of bacillithiol in Staphylococcus aureus.
Int. J. Med. Microbiol.: 2013, 303(3);114-23
[PubMed:23517692] [WorldCat.org] [DOI] (I p)