From AureoWiki
Jump to: navigation, search

NCBI: 03-AUG-2016

⊟Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_T00014
  • pan locus tag?: SAUPAN004812000
  • symbol: SAOUHSC_T00014
  • pan gene symbol?: trnaD
  • synonym:
  • product: tRNA-Asp

⊟Genome View[edit source | edit]

⊟Gene[edit source | edit]

⊟General[edit source | edit]

  • type: tRNA
  • locus tag: SAOUHSC_T00014
  • symbol: SAOUHSC_T00014
  • product: tRNA-Asp
  • replicon: chromosome
  • strand: -
  • coordinates: 1900177..1900252
  • length: 76
  • essential: unknown

⊟Accession numbers[edit source | edit]

⊟Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit source | edit]

  • 1
    61
    GGTCTCGTAGTGTAGCGGTTAACACGCCTGCCTGTCACGCAGGAGATCGCGGGTTCGATT
    CCCGTCGAGACCGCCA
    60
    76

⊟Protein[edit source | edit]

⊟General[edit source | edit]

  • locus tag: SAOUHSC_T00014
  • symbol: SAOUHSC_T00014
  • description: tRNA-Asp
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

⊟Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:

⊟Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

⊟Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

⊟Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt:

⊟Protein sequence[edit source | edit]

⊟Experimental data[edit source | edit]

  • experimentally validated: no data available

⊟Expression & Regulation[edit source | edit]

⊟Operon[edit source | edit]

  • MicrobesOnline: SAOUHSC_T00014 no polycistronic organisation predicted

⊟Regulation[edit source | edit]

  • sigma factor:
  • regulator:

⊟Transcription pattern[edit source | edit]

⊟Protein synthesis (provided by Aureolib)[edit source | edit]

⊟Protein stability[edit source | edit]

  • half-life: no data available

⊟Biological Material[edit source | edit]

⊟Mutants[edit source | edit]

⊟Expression vector[edit source | edit]

⊟lacZ fusion[edit source | edit]

⊟GFP fusion[edit source | edit]

⊟two-hybrid system[edit source | edit]

⊟FLAG-tag construct[edit source | edit]

⊟Antibody[edit source | edit]

⊟Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

⊟Literature[edit source | edit]

⊟References[edit source | edit]

⊟Relevant publications[edit source | edit]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_T00014&oldid=100404"