From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 27-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SAP008 [new locus tag: SA_RS00030 ]
  • pan locus tag?:
  • symbol: SAP008
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAP008 [new locus tag: SA_RS00030 ]
  • symbol: SAP008
  • product: hypothetical protein
  • replicon: pN315
  • strand: -
  • coordinates: 5905..6876
  • length: 972
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGTTCAATGCGGTAGTAGTGAGAAAAAGTGCATCAAATGTTAGTTATAAAGTAGAAAAA
    GTTGATGAATCTCATTTATCGAAGGGTGATGTATTAGTAAAAGTGGTATACTCTTCAATA
    AATTATAAGGATATGCTAGCTTTACAATATAAAGGCGGTGTAATTAGAGATTATCCTATG
    ATTCCTGGTATAGATTTTGCAGGTATTGTTGAATCAAGTTCGAATGATAAGTTTAAAGAA
    GGCGATAATGTATTAGTTACTGGTTATGATGTTGGCGTGACACATACAGGTGGATTTTCA
    GAATATGCACAAGTGCCTGGAGAGTGGATTGTTCCTATTCCCCAAGAAATGTCTATTAAA
    GAGTCTATGGTATATGGCACAGCCGGTTTTACGGCAGCATTATCAATTTTTGAACTAGAA
    AAATATGGAATGAATATCAAATCACAACCTGAAATTTTAGTGTCTGGGGCTACAGGTGGT
    GTGGGCAGTGTTGCTATACAAATTTTACATAAAATTGGATATGAAAATATCACTGCTATC
    GTAAGAAAAGAAAAGCAAATAGAAATCGCAAAAAAATTAGGTGCAAAACAAGTAATAATA
    ATTGAAGATGATAATAAACCGCTTAAAAAAGGTATTTTTGATTATTTCTTAGATACAGTG
    GGGAGTAATGTAACATTATACGGTTTAAAACGTCTAAATTATCAAGGTGTTGCTACTGTA
    TGTGGAAATGTAGCAGGAAATTCACTTAACGCTAATATATTACCGTTTATTCTTAGAGGT
    ATTAAATTAATTGGCATTGATTCTGTATATGTTGATCATAATATCCGTGAAGATATATGG
    AGTAAGTTAGCAAATGAATGGAATATAGGAAATTCACTTCTATACAATGAAATTGGATTT
    GAAGAATTCTATAAAACGATAGATCAGCTTTTAAAAGGACAACATTTAGGAAGAACTATT
    TTAAAAGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    972

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAP008 [new locus tag: SA_RS00030 ]
  • symbol: SAP008
  • description: hypothetical protein
  • length: 323
  • theoretical pI: 6.69127
  • theoretical MW: 35597.7
  • GRAVY: 0.00495356

Function[edit source | edit]

  • TIGRFAM:
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 425.7)
    and 15 more
    Unknown functionEnzymes of unknown specificityputative NAD(P)H quinone oxidoreductase, PIG3 family (TIGR02824; HMM-score: 98.9)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 67.8)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 56.5)
    Unknown functionEnzymes of unknown specificityNDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 42.5)
    MetabolismEnergy metabolismAmino acids and aminesL-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 42.3)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 39.8)
    MetabolismEnergy metabolismFermentationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 39.8)
    leukotriene B4 12-hydroxydehydrogenase/15-oxo-prostaglandin 13-reductase (TIGR02825; EC 1.3.1.48,1.3.1.74; HMM-score: 36.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllchlorophyll synthesis pathway protein BchC (TIGR01202; HMM-score: 32.5)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 29.5)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 23.5)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 21.9)
    MetabolismCentral intermediary metabolismOtherlong-chain fatty acyl-ACP reductase (aldehyde-forming) (TIGR04058; EC 1.1.1.-; HMM-score: 12.6)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02822; EC 1.-.-.-; HMM-score: 12.3)
    hopanoid-associated sugar epimerase (TIGR03466; HMM-score: 11.2)
  • TheSEED:  
    Fermentations: Lactate Acryloyl-CoA reductase AcuI/YhdH (EC 1.3.1.84) 
    and 2 more
    Fermentations: Mixed acid Acryloyl-CoA reductase AcuI/YhdH (EC 1.3.1.84) 
    Glycerolipid and Glycerophospholipid Metabolism in Bacteria Acryloyl-CoA reductase AcuI/YhdH (EC 1.3.1.84) 
  • PFAM:
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 53.1)
    and 6 more
    GroES (CL0296) ADH_N; Alcohol dehydrogenase GroES-like domain (PF08240; HMM-score: 31.7)
    NADP_Rossmann (CL0063) DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 19.3)
    NmrA; NmrA-like family (PF05368; HMM-score: 16.5)
    NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 16.4)
    GroES (CL0296) ADH_N_2; N-terminal domain of oxidoreductase (PF16884; HMM-score: 15.9)
    NADP_Rossmann (CL0063) Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 13.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.168
    • Ymax_pos: 21
    • Cmax: 0.127
    • Cmax_pos: 22
    • Smax: 0.289
    • Smax_pos: 1
    • Smean: 0.232
    • D: 0.193
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFNAVVVRKSASNVSYKVEKVDESHLSKGDVLVKVVYSSINYKDMLALQYKGGVIRDYPMIPGIDFAGIVESSSNDKFKEGDNVLVTGYDVGVTHTGGFSEYAQVPGEWIVPIPQEMSIKESMVYGTAGFTAALSIFELEKYGMNIKSQPEILVSGATGGVGSVAIQILHKIGYENITAIVRKEKQIEIAKKLGAKQVIIIEDDNKPLKKGIFDYFLDTVGSNVTLYGLKRLNYQGVATVCGNVAGNSLNANILPFILRGIKLIGIDSVYVDHNIREDIWSKLANEWNIGNSLLYNEIGFEEFYKTIDQLLKGQHLGRTILKV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAP008 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]