Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 27-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SAP031 [new locus tag: SA_RS00140 ]
  • pan locus tag?:
  • symbol: SAP031
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAP031 [new locus tag: SA_RS00140 ]
  • symbol: SAP031
  • product: hypothetical protein
  • replicon: pN315
  • strand: -
  • coordinates: 23716..24459
  • length: 744
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAAAGTGTGAAAAAGTTGAGTGAAGAATTAGGGGTTAGTAAGCAAACGATTTTTAAT
    AATATTAAGCGATTGAATATAGAGACAATAAAACAGGAAAACACTTCGTTTATTAAAGAA
    GATACCGATATAGAAAAAATCATTCGAAGAGTAAATGAAAATAAAAAGAAATATGGTTTT
    GAAAGTACTACTGAAGACAAACAAAAAAAAGGGTCGGATAATATTAATTTTGAATCGAAA
    AGCGATGCTCAAATAGTAGAAATCCTTAAAAATCAGATTGATACTTTAAATAATCAAATT
    GAAAAACAAGAAAGTCGTCATGAAACAACAATTGAATTTTACAGAAAAGAGTTGCAAGAA
    AGATCAAAATTGCTTGAAAATCAGCAAGTTCTGGCATTAGAGAGTAATAAAAAGATTCAA
    AAATTAGAAAATCAATTAGAAAAAGAAAAACACCTTAATTATCCCTTTGATACATCTACT
    AACACTAGACAAAACGTTGATGCACAAGAAAAAACATATACTACTAATCCTGTAAATATT
    AACAGAGATCAGGAAGAAACTAAAGAAACAGAGATTCAATATAAGGATATATCTGGAAGT
    CAAAGCGACGAAAGTACACAAGGTGAAGAAGCAAAAAAAGAAGACGTTCCAGCTAATCTA
    AATGACAATGATAGTGATATAGAAGAAAAGAGTGAAGAAACGGAACCTAAAAAGGGGTTT
    TGGAGTCGTTTGTTTGGTAGCTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    744

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAP031 [new locus tag: SA_RS00140 ]
  • symbol: SAP031
  • description: hypothetical protein
  • length: 247
  • theoretical pI: 4.77953
  • theoretical MW: 28861.5
  • GRAVY: -1.33684

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismthymidylate synthase (TIGR03284; EC 2.1.1.45; HMM-score: 15.7)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 6.4)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 6.4)
  • TheSEED:  
    Replication-associated protein 
  • PFAM:
    no clan definedDUF536; Protein of unknown function, DUF536 (PF04394; HMM-score: 51.2)
    HTH (CL0123) HTH_11; HTH domain (PF08279; HMM-score: 21.3)
    HTH_22; HTH domain (PF13309; HMM-score: 16.7)
    GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 16.6)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 16.1)
    HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 13.4)
    HTH_29; Winged helix-turn helix (PF13551; HMM-score: 13.1)
    HTH_10; HTH DNA binding domain (PF04967; HMM-score: 13)
    NUMOD1; NUMOD1 domain (PF07453; HMM-score: 12.8)
    TIM_barrel (CL0036) Glu_synthase; Conserved region in glutamate synthase (PF01645; HMM-score: 9.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.164
    • Ymax_pos: 11
    • Cmax: 0.11
    • Cmax_pos: 39
    • Smax: 0.368
    • Smax_pos: 1
    • Smean: 0.238
    • D: 0.193
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKSVKKLSEELGVSKQTIFNNIKRLNIETIKQENTSFIKEDTDIEKIIRRVNENKKKYGFESTTEDKQKKGSDNINFESKSDAQIVEILKNQIDTLNNQIEKQESRHETTIEFYRKELQERSKLLENQQVLALESNKKIQKLENQLEKEKHLNYPFDTSTNTRQNVDAQEKTYTTNPVNINRDQEETKETEIQYKDISGSQSDESTQGEEAKKEDVPANLNDNDSDIEEKSEETEPKKGFWSRLFGS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAP031 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]