From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0075 [new locus tag: SAUSA300_RS00380 ]
  • pan locus tag?: SAUPAN000823000
  • symbol: opp-3C
  • pan gene symbol?: opp-3C
  • synonym:
  • product: oligopeptide permease, channel-forming protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_0075 [new locus tag: SAUSA300_RS00380 ]
  • symbol: opp-3C
  • product: oligopeptide permease, channel-forming protein
  • replicon: chromosome
  • strand: +
  • coordinates: 82906..83673
  • length: 768
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAAAAATATCAAACGTACATCGCAATAGGTTCACTATTGAGTTTGATGGTTGTATTA
    ATTACGTATGGTTTAATGCAAGACACGCAACATTTGAACCCACTTGAGTCACCTAATGGA
    CAACATTGGTTGGGTACCGATCAATTAGGCAGAGACTTCTTAGTAAGACTGATTGTCGGT
    AGTCTTGTCACATTGAGTTTAACAGGCATAGTGATTCTATTAAGCGTTTGTATGGGACTT
    ATCTTTGGCTTAATTGCAGGCATAGAAAGACGATGGTTAGATCAAATCATCATGTTTGTT
    GCCGATATGTTGCTGGCTATTCCGTCATTTATTATCGCATTAGTCATCTTAAGTTTAGTA
    AGTAACTCCATGATAGGTTTGATACTTGCTTTAACGATTGGATGGATAGGACGTTATTTA
    CGTTACTTCAGAAATTTAACGCGAGATATTCAAAAACGTCCATTTGTTCAATATGCACGA
    TTGAGTGGGAACTCAACATTCAAAACGACAGTAACACATGTGATTCCACATTTATTAAGT
    AGTATATTCGCTTTGGTAACGGCTGACTTTGGCAAAATGATGCTCAGCATATCTGGACTT
    GCTTTTCTAGGACTAGGTATTAAACCGCCGACGCCTGAGTTAGGAACAATTCTTTTTGAT
    GGGAAAAGTTATTTCAACGGCGCACCGTGGCTCTTCTTCTTCCCTGGTGTATTGTTAGGA
    GGTTTCGCCTTATTATGTCAAATTATCAACAAAAAAATAACGCAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    768

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_0075 [new locus tag: SAUSA300_RS00380 ]
  • symbol: Opp-3C
  • description: oligopeptide permease, channel-forming protein
  • length: 255
  • theoretical pI: 10.1061
  • theoretical MW: 28224.7
  • GRAVY: 0.747843

Function[edit source | edit]

  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel ABC transporter, permease subunit NikC (TIGR02790; EC 3.6.3.24; HMM-score: 180.3)
    and 5 more
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, permease protein PhnE (TIGR01097; HMM-score: 35.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel ABC transporter, permease subunit NikB (TIGR02789; EC 3.6.3.24; HMM-score: 29.4)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, permease protein PstA (TIGR00974; HMM-score: 15.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesamino ABC transporter, permease protein, 3-TM region, His/Glu/Gln/Arg/opine family (TIGR01726; HMM-score: 9.3)
    ectoine/hydroxyectoine ABC transporter, permease protein EhuD (TIGR03003; HMM-score: 8.3)
  • TheSEED:  
    Membrane TransportMembrane Transport - no subcategoryTransport of Nickel and Cobalt Nickel transport system permease protein NikC (TC 3.A.1.5.3) 
  • PFAM:
    BPD_transp_1 (CL0404) BPD_transp_1; Binding-protein-dependent transport system inner membrane component (PF00528; HMM-score: 74.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.2
    • Ymax_pos: 32
    • Cmax: 0.122
    • Cmax_pos: 28
    • Smax: 0.524
    • Smax_pos: 26
    • Smean: 0.301
    • D: 0.24
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKKYQTYIAIGSLLSLMVVLITYGLMQDTQHLNPLESPNGQHWLGTDQLGRDFLVRLIVGSLVTLSLTGIVILLSVCMGLIFGLIAGIERRWLDQIIMFVADMLLAIPSFIIALVILSLVSNSMIGLILALTIGWIGRYLRYFRNLTRDIQKRPFVQYARLSGNSTFKTTVTHVIPHLLSSIFALVTADFGKMMLSISGLAFLGLGIKPPTPELGTILFDGKSYFNGAPWLFFFPGVLLGGFALLCQIINKKITQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]