NCBI: 10-JUN-2013
Contents
⊟Summary[edit source | edit]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1820 [new locus tag: SAUSA300_RS09950 ]
- pan locus tag?: SAUPAN004808000
- symbol: SAUSA300_1820
- pan gene symbol?: trnaL
- synonym:
- product: tRNA-Phe
⊟Genome View[edit source | edit]
⊟Gene[edit source | edit]
⊟General[edit source | edit]
- type: tRNA
- locus tag: SAUSA300_1820 [new locus tag: SAUSA300_RS09950 ]
- symbol: SAUSA300_1820
- product: tRNA-Phe
- replicon: chromosome
- strand: -
- coordinates: 1996020..1996092
- length: 73
- essential: unknown
⊟Accession numbers[edit source | edit]
- Gene ID: 3914173 NCBI
- RefSeq:
- MicrobesOnline: 1293335 MicrobesOnline
⊟Phenotype[edit source | edit]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit source | edit]
- 1
61GGTTCAGTAGCTCAGTTGGTAGAGCAATGGATTGAAGCTCCATGTGTCGGCAGTTCGACT
CTGTCCTGAACCA60
73
⊟Protein[edit source | edit]
⊟General[edit source | edit]
- locus tag: SAUSA300_1820 [new locus tag: SAUSA300_RS09950 ]
- symbol: SAUSA300_1820
- description: tRNA-Phe
- length: 0
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit source | edit]
- reaction:
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & interactions[edit source | edit]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
⊟Localization[edit source | edit]
- PSORTb:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit source | edit]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit source | edit]
⊟Experimental data[edit source | edit]
- experimentally validated: no data available
⊟Expression & Regulation[edit source | edit]
⊟Operon[edit source | edit]
- MicrobesOnline: SAUSA300_1813 < SAUSA300_1814 < SAUSA300_1815 < SAUSA300_1816 < SAUSA300_1817 < SAUSA300_1818 < SAUSA300_1819 < SAUSA300_1820 < SAUSA300_1821 < SAUSA300_1822 < SAUSA300_1823 < SAUSA300_1824 < SAUSA300_1825 < SAUSA300_1826 < SAUSA300_1827 < SAUSA300_1828 < SAUSA300_1829 < SAUSA300_1830 < SAUSA300_1831 < SAUSA300_1832 < SAUSA300_1833 < SAUSA300_1834 < SAUSA300_1835 < SAUSA300_1836 < rrfC
⊟Regulation[edit source | edit]
- sigma factor:
- regulator:
⊟Transcription pattern[edit source | edit]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit source | edit]
- Aureolib: no data available
⊟Protein stability[edit source | edit]
- half-life: no data available
⊟Biological Material[edit source | edit]
⊟Mutants[edit source | edit]
⊟Expression vector[edit source | edit]
⊟lacZ fusion[edit source | edit]
⊟GFP fusion[edit source | edit]
⊟two-hybrid system[edit source | edit]
⊟FLAG-tag construct[edit source | edit]
⊟Antibody[edit source | edit]
⊟Other Information[edit source | edit]
You are kindly invited to share additional interesting facts.
⊟Literature[edit source | edit]
⊟References[edit source | edit]
⊟Relevant publications[edit source | edit]