From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS00395 [old locus tag: SAUSA300_0078 ]
  • pan locus tag?: SAUPAN000827000
  • symbol: SAUSA300_RS00395
  • pan gene symbol?: copA
  • synonym:
  • product: copper-translocating P-type ATPase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS00395 [old locus tag: SAUSA300_0078 ]
  • symbol: SAUSA300_RS00395
  • product: copper-translocating P-type ATPase
  • replicon: chromosome
  • strand: +
  • coordinates: 86055..88118
  • length: 2064
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (86055..88118) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    TTGAATAATAATGGTGAAGAGCATAATCATCAAAATCACATGAATCATTCCAATCAAATG
    CATCATGATAACCATGCCTCACATGATCATCATAGTGGCCATGCACATCATCATGGAAAT
    TTTAAAGTTAAGTTTTTTGTTTCATTAATTTTTGCAATACCTATCATTCTTTTATCGCCA
    CTGATGGGTGTTAACTTACCTTTTCAATTCACATTTCCAGGTTCTGAATGGGTAGTGTTA
    ATATTAAGTACAATTTTATTCTTTTATGGTGGTAAACCGTTCTTGTCTGGTGGTAAAGAT
    GAAATTGCTACAAAAAAACCAGGCATGATGACCTTAGTTGCCCTAGGTATTTCAGTAGCT
    TATATTTATAGCTTGTATGCTTTTTATATGAATAACTTTAGTAGTGCAACTGGTCATACA
    ATGGACTTTTTTTGGGAATTAGCAACCTTAATTTTAATTATGCTATTAGGACATTGGATA
    GAAATGAATGCTGTCGGAAATGCTGGAGATGCTTTAAAGAAAATGGCAGAACTGTTACCT
    AATAGTGCTATTAAAGTTATGGATAATGGCCAACGCGAAGAAGTTAAAATATCAGACATC
    ATGACTGATGATATCGTCGAAGTAAAAGCCGGAGAAAGCATTCCAACAGATGGTATTATC
    GTTCAAGGACAAACATCTATAGATGAATCCCTAGTCACTGGAGAATCTAAAAAAGTACAA
    AAAAATCAAAATGACAACGTCATCGGGGGTTCTATTAATGGGTCTGGAACAATACAAGTC
    AAGGTTACAGCTGTGGGAGAAGATGGATATCTTTCTCAAGTTATGGGACTTGTTAATCAA
    GCACAAAATGATAAATCTAGTGCTGAATTGTTATCTGATAAAGTAGCGGGTTATTTATTC
    TACTTTGCTGTAAGTGTTGGCGTGATTTCTTTTATTGTCTGGATGCTCATTCAAAATGAT
    GTTGATTTTGCATTAGAACGTCTTGTAACTGTGTTAGTCATTGCTTGTCCACATGCTTTA
    GGCTTGGCAATACCTTTAGTCACTGCACGTTCTACTTCAATTGGTGCACATAATGGTTTA
    ATTATTAAAAATAGAGAGTCTGTAGAAATAGCTCAACATATCGATTATGTAATGATGGAC
    AAAACTGGTACTTTAACTGAGGGTAACTTTTCTGTGAATCATTATGAGAGCTTTAAAAAT
    GATTTGAGTAATGATACAATATTAAGCCTTTTCGCCTCATTAGAAAGTCAATCTAATCAC
    CCATTAGCTATAAGTATTGTTGATTTTGCGAAAAGTAAAAATGTTTCATTTACTAACCCA
    CAAGACGTTAATAATATTCCAGGTGTCGGATTAGAAGGTCTAATTGATAATAAAACATAT
    AAAATAACAAATGTCTCTTATCTTGATAAACATAAACTTAATTATGACGATGACTTGTTT
    ACTAAATTAGCTCAACAAGGTAATTCAATCAGTTATTTAATTGAGGATCAACAAGTCATT
    GGCATGATTGCTCAAGGAGATCAAATTAAAGAAAGCTCAAAACAAATGGTAGCTGATTTA
    CTATCAAGAAATATTACACCAGTCATGCTTACAGGTGACAATAATGAAGTGGCACACGCT
    GTCGCAAAAGAATTAGGTATTAGTGATGTCCACGCACAACTCATGCCAGAAGATAAGGAA
    AGCATTATAAAAGATTATCAAAGTGACGGTAATAAAGTCATGATGGTCGGAGACGGTATC
    AACGATGCGCCGAGTCTTATAAGAGCGGATATTGGTATAGCAATTGGTGCAGGTACAGAT
    GTTGCAGTGGATTCAGGTGATATCATACTTGTTAAAAGTAATCCATCAGATATCATTCAT
    TTCTTGACCCTTTCAAATAATACTATGAGAAAAATGGTGCAAAACTTATGGTGGGGTGCA
    GGTTATAATATTGTTGCTGTACCTTTAGCAGCTGGTATTTTAGCATTTATTGGCTTGATT
    TTATCACCTGCAATAGGTGCTATTTTAATGTCTTTAAGTACAATTATCGTTGCAATTAAT
    GCCTTTACATTAAAATTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2064

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS00395 [old locus tag: SAUSA300_0078 ]
  • symbol: SAUSA300_RS00395
  • description: copper-translocating P-type ATPase
  • length: 687
  • theoretical pI: 5.28506
  • theoretical MW: 74723.1
  • GRAVY: 0.11441

Function[edit source | edit]

  • reaction:
    EC 3.6.3.4?  ExPASy
    Cu2+-exporting ATPaseATP + H2O + Cu2+(Side 1) = ADP + phosphate + Cu2+(Side 2)
  • TIGRFAM:
    Cellular processesCellular processesDetoxificationcopper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 609.4)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscopper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 609.4)
    heavy metal translocating P-type ATPase (TIGR01525; EC 3.6.3.-; HMM-score: 578)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscadmium-translocating P-type ATPase (TIGR01512; EC 3.6.3.3; HMM-score: 369.1)
    HAD ATPase, P-type, family IC (TIGR01494; EC 3.6.3.-; HMM-score: 288.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsK+-transporting ATPase, B subunit (TIGR01497; EC 3.6.3.12; HMM-score: 183.4)
    plasma-membrane proton-efflux P-type ATPase (TIGR01647; EC 3.6.3.6; HMM-score: 176.4)
    calcium-translocating P-type ATPase, PMCA-type (TIGR01517; EC 3.6.3.8; HMM-score: 145.3)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsmagnesium-translocating P-type ATPase (TIGR01524; EC 3.6.3.2; HMM-score: 111.7)
    P-type ATPase of unknown pump specificity (type V) (TIGR01657; HMM-score: 109.1)
    calcium-transporting P-type ATPase, PMR1-type (TIGR01522; EC 3.6.3.8; HMM-score: 107.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscalcium-translocating P-type ATPase, SERCA-type (TIGR01116; EC 3.6.3.8; HMM-score: 101.9)
    MetabolismEnergy metabolismATP-proton motive force interconversionNa,H/K antiporter P-type ATPase, alpha subunit (TIGR01106; EC 3.6.3.-; HMM-score: 91.1)
    potassium/sodium efflux P-type ATPase, fungal-type (TIGR01523; EC 3.6.3.-; HMM-score: 73.1)
    Unknown functionEnzymes of unknown specificityCof-like hydrolase (TIGR00099; HMM-score: 21.7)
    MetabolismAmino acid biosynthesisSerine familyphosphoserine phosphatase SerB (TIGR00338; EC 3.1.3.3; HMM-score: 21.4)
    phosphoglycolate phosphatase, TA0175-type (TIGR01487; EC 3.1.3.18; HMM-score: 18.4)
    phospholipid-translocating P-type ATPase, flippase (TIGR01652; EC 3.6.3.1; HMM-score: 15.6)
  • TheSEED:
  • PFAM:
    no clan definedE1-E2_ATPase; E1-E2 ATPase (PF00122; HMM-score: 164.6)
    HAD (CL0137) Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 120.7)
    Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 18.8)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 18.4)
    no clan definedDUF1980; Domain of unknown function (DUF1980) (PF09323; HMM-score: 7.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0.01
    • Extracellular Score: 0.01
    • Internal Helices: 8
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.132
    • Ymax_pos: 36
    • Cmax: 0.111
    • Cmax_pos: 27
    • Smax: 0.216
    • Smax_pos: 25
    • Smean: 0.139
    • D: 0.135
  • predicted transmembrane helices (TMHMM): 8

Accession numbers[edit source | edit]

  • GI: 446986220 NCBI
  • RefSeq: WP_001063476 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNNNGEEHNHQNHMNHSNQMHHDNHASHDHHSGHAHHHGNFKVKFFVSLIFAIPIILLSPLMGVNLPFQFTFPGSEWVVLILSTILFFYGGKPFLSGGKDEIATKKPGMMTLVALGISVAYIYSLYAFYMNNFSSATGHTMDFFWELATLILIMLLGHWIEMNAVGNAGDALKKMAELLPNSAIKVMDNGQREEVKISDIMTDDIVEVKAGESIPTDGIIVQGQTSIDESLVTGESKKVQKNQNDNVIGGSINGSGTIQVKVTAVGEDGYLSQVMGLVNQAQNDKSSAELLSDKVAGYLFYFAVSVGVISFIVWMLIQNDVDFALERLVTVLVIACPHALGLAIPLVTARSTSIGAHNGLIIKNRESVEIAQHIDYVMMDKTGTLTEGNFSVNHYESFKNDLSNDTILSLFASLESQSNHPLAISIVDFAKSKNVSFTNPQDVNNIPGVGLEGLIDNKTYKITNVSYLDKHKLNYDDDLFTKLAQQGNSISYLIEDQQVIGMIAQGDQIKESSKQMVADLLSRNITPVMLTGDNNEVAHAVAKELGISDVHAQLMPEDKESIIKDYQSDGNKVMMVGDGINDAPSLIRADIGIAIGAGTDVAVDSGDIILVKSNPSDIIHFLTLSNNTMRKMVQNLWWGAGYNIVAVPLAAGILAFIGLILSPAIGAILMSLSTIIVAINAFTLKLK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS00395 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]