From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 23-MAY-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_pUSA030007 [new locus tag: SAUSA300_RS14770 ]
  • pan locus tag?:
  • symbol: ermC
  • pan gene symbol?:
  • synonym:
  • product: rRNA adenine N-6-methyltransferase (macrolide-lincosamide-streptogramin B resistance protein)

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_pUSA030007 [new locus tag: SAUSA300_RS14770 ]
  • symbol: ermC
  • product: rRNA adenine N-6-methyltransferase (macrolide-lincosamide-streptogramin B resistance protein)
  • replicon: pUSA03
  • strand: +
  • coordinates: 7865..8599
  • length: 735
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAACGAGAAAAATATAAAACACAGTCAAAACTTTATTACTTCAAAACATAATATAGAT
    AAAATAATGACAAATATAAGATTAAATGAACATGATAATATCTTTGAAATCGGCTCAGGA
    AAAGGGCATTTTACCCTTGAATTAGTACAGAGGTGTAATTTCGTAACTGCCATTGAAATA
    GACCATAAATTATGCAAAACTACAGAAAATAAACTTGTTGATCACGATAATTTCCAAGTT
    TTAAACAAGGATATATTGCAGTTTAAATTTCCTAAAAACCAATCCTATAAAATATTTGGT
    AATATACCTTATAACATAAGTACGGATATAATACGCAAAATTGTTTTTGATAGTATAGCT
    GATGAGATTTATTTAATCGTGGAATACGAGTTTGCTAAAAGATTATTAAATACAAAACGC
    TCATTGGCATTATTTTTAATGGCAGAAGTTGATATTTCTATATTAAGTATGGTTCCAAGA
    GAATATTTTCATCCTAAACCTAAAGTGAATAGCTCACTTATCAGATTAAATAGAAAAAAA
    TCAAGAATATCACACAAAGATAAACAGAAGTATAATTATTTCGTTATGAAATGGGTTAAC
    AAAGAATACAAGAAAATATTTACAAAAAATCAATTTAACAATTCCTTAAAACATGCAGGA
    ATTGACGATTTAAACAATATTAGCTTTGAACAATTCTTATCTCTTTTCAATAGCTATAAA
    TTATTTAATAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    735

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_pUSA030007 [new locus tag: SAUSA300_RS14770 ]
  • symbol: ErmC
  • description: rRNA adenine N-6-methyltransferase (macrolide-lincosamide-streptogramin B resistance protein)
  • length: 244
  • theoretical pI: 10.1364
  • theoretical MW: 28979.3
  • GRAVY: -0.480738

Function[edit source | edit]

  • reaction:
    EC 2.1.1.48?  ExPASy
    Transferred entry: 2.1.1.181, 2.1.1.182, 2.1.1.183 and 2.1.1.184
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationribosomal RNA small subunit methyltransferase A (TIGR00755; EC 2.1.1.182; HMM-score: 155)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 27.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinmalonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 23.3)
    Unknown functionEnzymes of unknown specificityputative methylase (TIGR00537; HMM-score: 23.2)
    Genetic information processingProtein fateProtein modification and repairprotein-L-isoaspartate O-methyltransferase (TIGR00080; EC 2.1.1.77; HMM-score: 17.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 16.6)
  • TheSEED:  
    23S rRNA (adenine(2058)-N(6))-dimethyltransferase (EC 2.1.1.184) => Erm(C) 
  • PFAM:
    NADP_Rossmann (CL0063) RrnaAD; Ribosomal RNA adenine dimethylase (PF00398; HMM-score: 207.3)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 26.6)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 23.3)
    PCMT; Protein-L-isoaspartate(D-aspartate) O-methyltransferase (PCMT) (PF01135; HMM-score: 19.6)
    NodS; Nodulation protein S (NodS) (PF05401; HMM-score: 16.4)
    DOT1; Histone methylation protein DOT1 (PF08123; HMM-score: 16.3)
    Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 15.9)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 13.6)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 13)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 12.9)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 12.9)
    DnaA_N (CL0494) DnaA_N; DnaA N-terminal domain (PF11638; HMM-score: 11.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.129
    • Ymax_pos: 12
    • Cmax: 0.16
    • Cmax_pos: 58
    • Smax: 0.201
    • Smax_pos: 2
    • Smean: 0.163
    • D: 0.142
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNEKNIKHSQNFITSKHNIDKIMTNIRLNEHDNIFEIGSGKGHFTLELVQRCNFVTAIEIDHKLCKTTENKLVDHDNFQVLNKDILQFKFPKNQSYKIFGNIPYNISTDIIRKIVFDSIADEIYLIVEYEFAKRLLNTKRSLALFLMAEVDISILSMVPREYFHPKPKVNSSLIRLNRKKSRISHKDKQKYNYFVMKWVNKEYKKIFTKNQFNNSLKHAGIDDLNNISFEQFLSLFNSYKLFNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]