From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS00485
  • pan locus tag?:
  • symbol: SA_RS00485
  • pan gene symbol?:
  • synonym:
  • product: potassium-transporting ATPase subunit F

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS00485
  • symbol: SA_RS00485
  • product: potassium-transporting ATPase subunit F
  • replicon: chromosome
  • strand: +
  • coordinates: 77015..77095
  • length: 81
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (77015..77095) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    ATGATTACACTATTAGCTGTCGTTGTCATCGCATTAATTTTATTTTTATTTTACGCATTA
    ATTTGGAGTGAAAAATTTTAA
    60
    81

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS00485
  • symbol: SA_RS00485
  • description: potassium-transporting ATPase subunit F
  • length: 26
  • theoretical pI: 6.40195
  • theoretical MW: 3027.8
  • GRAVY: 2.23077

Function[edit source | edit]

  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundsK+-transporting ATPase, F subunit (TIGR02115; EC 3.6.3.12; HMM-score: 27.7)
  • TheSEED:
  • PFAM:
    no clan definedPotass_KdpF; F subunit of K+-transporting ATPase (Potass_KdpF) (PF09604; HMM-score: 29.8)
    and 3 more
    P12; Virus attachment protein p12 family (PF12669; HMM-score: 10.4)
    EpsM (CL0331) T2SSM; Type II secretion system (T2SS), protein M (PF04612; HMM-score: 8.9)
    no clan definedODV-E18; Occlusion-derived virus envelope protein ODV-E18 (PF10717; HMM-score: 8.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.11
    • Ymax_pos: 11
    • Cmax: 0.112
    • Cmax_pos: 22
    • Smax: 0.203
    • Smax_pos: 1
    • Smean: 0.101
    • D: 0.107
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446554228 NCBI
  • RefSeq: WP_000631574 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MITLLAVVVIALILFLFYALIWSEKF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS00485 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]