From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13650 [old locus tag: SA2384 ]
  • pan locus tag?: SAUPAN006286000
  • symbol: SA_RS13650
  • pan gene symbol?: ermA
  • synonym:
  • product: 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS13650 [old locus tag: SA2384 ]
  • symbol: SA_RS13650
  • product: 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)
  • replicon: chromosome
  • strand: +
  • coordinates: 2672535..2673266
  • length: 732
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2672535..2673266) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAACCAGAAAAACCCTAAAGACACGCAAAATTTTATTACTTCTAAAAAGCATGTAAAA
    GAAATATTGAATCACACGAATATCAGTAAACAAGACAACGTAATAGAAATCGGATCAGGA
    AAAGGACATTTTACCAAAGAGCTAGTCAAAATGAGTCGATCAGTTACTGCTATAGAAATT
    GATGGAGGCTTATGTCAAGTGACTAAAGAAGCGGTAAACCCCTCTGAGAATATAAAAGTG
    ATTCAAACGGATATTCTAAAATTTTCCTTCCCAAAACATATAAACTATAAGATATATGGT
    AATATTCCTTATAACATCAGTACGGATATTGTCAAAAGAATTACCTTTGAAAGTCAGGCT
    AAATATAGCTATCTTATCGTTGAGAAGGGATTTGCGAAAAGATTGCAAAATCTGCAACGA
    GCTTTGGGTTTACTATTAATGGTGGAGATGGATATAAAAATGCTCAAAAAAGTACCACCA
    CTATATTTTCATCCTAAGCCAAGTGTAGACTCTGTATTGATTGTTCTTGAACGACATCAA
    CCATTGATTTCAAAGAAGGACTACAAAAAGTATCGATCTTTTGTTTATAAGTGGGTAAAC
    CGTGAATATCGTGTTCTTTTCACTAAAAACCAATTCCGACAGGCTTTGAAGCATGCAAAT
    GTCACTAATATTAATAAACTATCGAAGGAACAATTTCTTTCTATTTTCAATAGTTACAAA
    TTGTTTCACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS13650 [old locus tag: SA2384 ]
  • symbol: SA_RS13650
  • description: 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)
  • length: 243
  • theoretical pI: 10.5175
  • theoretical MW: 28408
  • GRAVY: -0.430453

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationribosomal RNA small subunit methyltransferase A (TIGR00755; EC 2.1.1.182; HMM-score: 141.2)
    Unknown functionEnzymes of unknown specificityputative methylase (TIGR00537; HMM-score: 25)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinmalonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 24.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 20.9)
    Genetic information processingProtein fateProtein modification and repairprotein-L-isoaspartate O-methyltransferase (TIGR00080; EC 2.1.1.77; HMM-score: 15.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 15.1)
    Genetic information processingProtein synthesistRNA and rRNA base modification23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 14.6)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 13.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 13.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 12.9)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) RrnaAD; Ribosomal RNA adenine dimethylase (PF00398; HMM-score: 253.3)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 27.2)
    NodS; Nodulation protein S (NodS) (PF05401; HMM-score: 24.9)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 23.6)
    PCMT; Protein-L-isoaspartate(D-aspartate) O-methyltransferase (PCMT) (PF01135; HMM-score: 17.3)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 17)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 15.8)
    FtsJ; FtsJ-like methyltransferase (PF01728; HMM-score: 15.1)
    DOT1; Histone methylation protein DOT1 (PF08123; HMM-score: 14.9)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 14.8)
    Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 13.5)
    LYR-like (CL0491) Complex1_LYR_2; Complex1_LYR-like (PF13233; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.172
    • Ymax_pos: 13
    • Cmax: 0.109
    • Cmax_pos: 31
    • Smax: 0.355
    • Smax_pos: 7
    • Smean: 0.298
    • D: 0.221
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446994945 NCBI
  • RefSeq: WP_001072201 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNQKNPKDTQNFITSKKHVKEILNHTNISKQDNVIEIGSGKGHFTKELVKMSRSVTAIEIDGGLCQVTKEAVNPSENIKVIQTDILKFSFPKHINYKIYGNIPYNISTDIVKRITFESQAKYSYLIVEKGFAKRLQNLQRALGLLLMVEMDIKMLKKVPPLYFHPKPSVDSVLIVLERHQPLISKKDYKKYRSFVYKWVNREYRVLFTKNQFRQALKHANVTNINKLSKEQFLSIFNSYKLFH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS13650 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]