From AureoWiki
Jump to navigation Jump to search

NCBI: 01-DEC-2025

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_001576 [new locus tag: EGJ38_RS07870 ]
  • pan locus tag?: SAUPAN004172000
  • symbol: rpsT
  • pan gene symbol?: rpsT
  • synonym:
  • alternate name: JSNZ_001576
  • product: 30S ribosomal protein S20

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_001576 [new locus tag: EGJ38_RS07870 ]
  • symbol: rpsT
  • product: 30S ribosomal protein S20
  • replicon: chromosome
  • strand: +
  • coordinates: 1613922..1614173
  • length: 252
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq: MGT2423533 NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    ATGGCAAATATCAAATCTGCAATTAAACGTGTAAAAACAACTGAAAAAGCTGAAGCACGC
    AACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAACGCTAAAACAGCTGTTTCA
    AATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGTTAAGTTAGTAGACAAAGCT
    GCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACAATTAATGACT
    GCAAATAAATAA
    60
    120
    180
    240
    252


Protein[edit | edit source]

Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5TCU

General[edit | edit source]

  • locus tag: EGJ38_001576 [new locus tag: EGJ38_RS07870 ]
  • symbol: RpsT
  • description: 30S ribosomal protein S20
  • length: 83
  • theoretical pI: 11.2814
  • theoretical MW: 9021.38
  • GRAVY: -0.610843

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS20 (TIGR00029; HMM-score: 68)
    and 1 more
    Metabolism Energy metabolism Amino acids and amines tryptophan 2,3-dioxygenase (TIGR03036; EC 1.13.11.11; HMM-score: 14.1)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    no clan defined Ribosomal_S20p; Ribosomal protein S20 (PF01649; HMM-score: 79.3)
    and 2 more
    Ubiquitin (CL0072) UN_NPL4; Nuclear pore localisation protein NPL4 (PF11543; HMM-score: 14)
    BRCT-like (CL0459) RTT107_BRCT_5; Regulator of Ty1 transposition protein 107 BRCT domain (PF16770; HMM-score: 12.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0.4398
    • Cytoplasmic Membrane Score: 0
    • Cell wall & surface Score: 0.0101
    • Extracellular Score: 0.5501
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.015523
    • TAT(Tat/SPI): 0.001531
    • LIPO(Sec/SPII): 0.001817
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: MGT2423533 NCBI
  • UniProt:

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MANIKSAIKRVKTTEKAEARNISQKSAMRTAVKNAKTAVSNNADNKNELVSLAVKLVDKAAQSNLIHSNKADRIKSQLMTANK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]