Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1545 [new locus tag: SAUSA300_RS08425 ]
- pan locus tag?: SAUPAN004172000
- symbol: rpsT
- pan gene symbol?: rpsT
- synonym:
- product: 30S ribosomal protein S20
⊟Additional information (user-provided)[edit | edit source]
rpsT : 30S ribosomal protein S20 [1]
• Two crystal structures are available : 6YEF , 8BH6
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1545 [new locus tag: SAUSA300_RS08425 ]
- symbol: rpsT
- product: 30S ribosomal protein S20
- replicon: chromosome
- strand: +
- coordinates: 1696903..1697154
- length: 252
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3913673 NCBI
- RefSeq: YP_494240 NCBI
- BioCyc: see SAUSA300_RS08425
- MicrobesOnline: 1293060 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGGCAAATATCAAATCTGCAATTAAACGTGTAAAAACAACTGAAAAAGCTGAAGCACGC
AACATTTCACAAAAGAGTGCAATGCGTACAGCAGTTAAAAACGCTAAAACAGCTGTTTCA
AATAACGCTGATAATAAAAATGAATTAGTAAGCTTAGCAGTTAAGTTAGTAGACAAAGCT
GCTCAAAGTAATTTAATACATTCAAACAAAGCTGACCGTATTAAATCACAATTAATGACT
GCAAATAAATAA60
120
180
240
252
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1545 [new locus tag: SAUSA300_RS08425 ]
- symbol: RpsT
- description: 30S ribosomal protein S20
- length: 83
- theoretical pI: 11.2814
- theoretical MW: 9021.38
- GRAVY: -0.610843
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS20 (TIGR00029; HMM-score: 68)and 1 moreEnergy metabolism Amino acids and amines tryptophan 2,3-dioxygenase (TIGR03036; EC 1.13.11.11; HMM-score: 14.1)
- TheSEED :
- SSU ribosomal protein S20p
- PFAM: no clan defined Ribosomal_S20p; Ribosomal protein S20 (PF01649; HMM-score: 79.3)and 2 moreUbiquitin (CL0072) UN_NPL4; Nuclear pore localisation protein NPL4 (PF11543; HMM-score: 14)BRCT-like (CL0459) RTT107_BRCT_5; Regulator of Ty1 transposition protein 107 BRCT domain (PF16770; HMM-score: 12.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0.4398
- Cytoplasmic Membrane Score: 0
- Cell wall & surface Score: 0.0101
- Extracellular Score: 0.5501
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.015523
- TAT(Tat/SPI): 0.001531
- LIPO(Sec/SPII): 0.001817
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MANIKSAIKRVKTTEKAEARNISQKSAMRTAVKNAKTAVSNNADNKNELVSLAVKLVDKAAQSNLIHSNKADRIKSQLMTANK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_1540 (dnaK) molecular chaperone DnaK [2] (data from MRSA252) SAUSA300_0760 (eno) phosphopyruvate hydratase [2] (data from MRSA252) SAUSA300_1678 (fhs) formate--tetrahydrofolate ligase [2] (data from MRSA252) SAUSA300_0532 (fusA) elongation factor G [2] (data from MRSA252) SAUSA300_0756 (gap) glyceraldehyde-3-phosphate dehydrogenase, type I [2] (data from MRSA252) SAUSA300_1362 (hup) DNA-binding protein HU [2] (data from MRSA252) SAUSA300_1640 (icd) isocitrate dehydrogenase [2] (data from MRSA252) SAUSA300_1162 (infB) translation initiation factor IF-2 [2] (data from MRSA252) SAUSA300_1627 (infC) translation initiation factor IF-3 [2] (data from MRSA252) SAUSA300_0996 (lpdA) dihydrolipoamide dehydrogenase [2] (data from MRSA252) SAUSA300_0220 (pflB) formate acetyltransferase [2] (data from MRSA252) SAUSA300_0523 (rplA) 50S ribosomal protein L1 [2] (data from MRSA252) SAUSA300_2201 (rplB) 50S ribosomal protein L2 [2] (data from MRSA252) SAUSA300_2204 (rplC) 50S ribosomal protein L3 [2] (data from MRSA252) SAUSA300_2203 (rplD) 50S ribosomal protein L4 [2] (data from MRSA252) SAUSA300_2192 (rplE) 50S ribosomal protein L5 [2] (data from MRSA252) SAUSA300_2189 (rplF) 50S ribosomal protein L6 [2] (data from MRSA252) SAUSA300_0524 (rplJ) 50S ribosomal protein L10 [2] (data from MRSA252) SAUSA300_0522 (rplK) 50S ribosomal protein L11 [2] (data from MRSA252) SAUSA300_0525 (rplL) 50S ribosomal protein L7/L12 [2] (data from MRSA252) SAUSA300_2185 (rplO) 50S ribosomal protein L15 [2] (data from MRSA252) SAUSA300_2197 (rplP) 50S ribosomal protein L16 [2] (data from MRSA252) SAUSA300_2177 (rplQ) 50S ribosomal protein L17 [2] (data from MRSA252) SAUSA300_1134 (rplS) 50S ribosomal protein L19 [2] (data from MRSA252) SAUSA300_1603 (rplU) 50S ribosomal protein L21 [2] (data from MRSA252) SAUSA300_2199 (rplV) 50S ribosomal protein L22 [2] (data from MRSA252) SAUSA300_2202 (rplW) 50S ribosomal protein L23 [2] (data from MRSA252) SAUSA300_1601 (rpmA) 50S ribosomal protein L27 [2] (data from MRSA252) SAUSA300_2074 (rpmE2) 50S ribosomal protein L31 type B [2] (data from MRSA252) SAUSA300_1149 (rpsB) 30S ribosomal protein S2 [2] (data from MRSA252) SAUSA300_2198 (rpsC) 30S ribosomal protein S3 [2] (data from MRSA252) SAUSA300_1666 (rpsD) 30S ribosomal protein S4 [2] (data from MRSA252) SAUSA300_2187 (rpsE) 30S ribosomal protein S5 [2] (data from MRSA252) SAUSA300_2171 (rpsI) 30S ribosomal protein S9 [2] (data from MRSA252) SAUSA300_2179 (rpsK) 30S ribosomal protein S11 [2] (data from MRSA252) SAUSA300_2195 (rpsQ) 30S ribosomal protein S17 [2] (data from MRSA252) SAUSA300_2200 (rpsS) 30S ribosomal protein S19 [2] (data from MRSA252) SAUSA300_1305 (sucB) dihydrolipoamide succinyltransferase [2] (data from MRSA252) SAUSA300_1622 (tig) trigger factor [2] (data from MRSA252) SAUSA300_1150 (tsf) elongation factor Ts [2] (data from MRSA252) SAUSA300_0533 (tuf) elongation factor Tu [2] (data from MRSA252) SAUSA300_0113 immunoglobulin G binding protein A [2] (data from MRSA252) SAUSA300_0307 5'-nucleotidase [2] (data from MRSA252) SAUSA300_0658 LysR family transcriptional regulator [2] (data from MRSA252) SAUSA300_0844 hypothetical protein [2] (data from MRSA252) SAUSA300_0989 hypothetical protein [2] (data from MRSA252) SAUSA300_0995 branched-chain alpha-keto acid dehydrogenase subunit E2 [2] (data from MRSA252) SAUSA300_1652 hypothetical protein [2] (data from MRSA252) SAUSA300_1874 ferritins family protein [2] (data from MRSA252) SAUSA300_2037 ATP-dependent RNA helicase [2] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Alexander Golubev, Bulat Fatkhullin, Iskander Khusainov, Lasse Jenner, Azat Gabdulkhakov, Shamil Validov, Gulnara Yusupova, Marat Yusupov, Konstantin Usachev
Cryo-EM structure of the ribosome functional complex of the human pathogen Staphylococcus aureus at 3.2 Å resolution.
FEBS Lett: 2020, 594(21);3551-3567
[PubMed:32852796] [WorldCat.org] [DOI] (I p) - ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)