From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2179 [new locus tag: SAUSA300_RS12025 ]
  • pan locus tag?: SAUPAN005677000
  • symbol: rpsK
  • pan gene symbol?: rpsK
  • synonym:
  • product: 30S ribosomal protein S11

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_2179 [new locus tag: SAUSA300_RS12025 ]
  • symbol: rpsK
  • product: 30S ribosomal protein S11
  • replicon: chromosome
  • strand: -
  • coordinates: 2358842..2359231
  • length: 390
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGCACGTAAACAAGTATCTCGTAAACGTAGAGTGAAAAAGAATATTGAAAATGGTGTA
    GCACACATCCGTTCAACATTCAACAACACTATTGTAACTATCACTGATGAGTTCGGTAAT
    GCTTTATCATGGTCATCAGCTGGTGCATTAGGATTCAAAGGATCTAAAAAATCAACACCA
    TTTGCAGCACAAATGGCTTCTGAAACTGCATCTAAATCAGCTATGGAGCATGGTTTAAAA
    ACAGTTGAAGTAACAGTTAAAGGACCTGGTCCAGGTCGTGAATCAGCTATTCGTGCATTA
    CAATCTGCAGGTTTAGAAGTAACTGCGATCAGAGACGTTACTCCAGTACCTCATAACGGT
    TGTCGTCCACCAAAACGTCGTCGTGTATAA
    60
    120
    180
    240
    300
    360
    390

⊟Protein[edit | edit source]

Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5TCU

⊟General[edit | edit source]

  • locus tag: SAUSA300_2179 [new locus tag: SAUSA300_RS12025 ]
  • symbol: RpsK
  • description: 30S ribosomal protein S11
  • length: 129
  • theoretical pI: 11.8008
  • theoretical MW: 13881.8
  • GRAVY: -0.510078

⊟Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS11 (TIGR03632; HMM-score: 197.1)
    and 1 more
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS11 (TIGR03628; HMM-score: 90.5)
  • TheSEED  :
    • SSU ribosomal protein S11p (S14e)
    Protein Metabolism Protein biosynthesis Ribosome SSU bacterial  SSU ribosomal protein S11p (S14e)
  • PFAM:
    S11_L18p (CL0267) Ribosomal_S11; Ribosomal protein S11 (PF00411; HMM-score: 171.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.045703
    • TAT(Tat/SPI): 0.006344
    • LIPO(Sec/SPII): 0.001844
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MARKQVSRKRRVKKNIENGVAHIRSTFNNTIVTITDEFGNALSWSSAGALGFKGSKKSTPFAAQMASETASKSAMEHGLKTVEVTVKGPGPGRESAIRALQSAGLEVTAIRDVTPVPHNGCRPPKRRRV

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAUSA300_2179&oldid=85422"