From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0996 [new locus tag: SAUSA300_RS05365 ]
  • pan locus tag?: SAUPAN003320000
  • symbol: lpdA
  • pan gene symbol?: pdhD
  • synonym:
  • product: dihydrolipoamide dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0996 [new locus tag: SAUSA300_RS05365 ]
  • symbol: lpdA
  • product: dihydrolipoamide dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1092012..1093418
  • length: 1407
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGTAGTTGGAGATTTCCCAATTGAAACAGATACTATAGTAATCGGAGCAGGTCCTGGT
    GGATACGTTGCAGCAATTCGTGCAGCTCAATTAGGACAAAAAGTAACAATCGTTGAGAAA
    GGTAATCTTGGTGGTGTTTGCTTAAACGTAGGATGTATTCCTTCAAAAGCATTACTACAT
    GCTTCTCACCGTTTTGTTGAAGCACAACATTCTGAAAACTTAGGTGTTATTGCTGAAAGT
    GTTTCTTTAAACTTCCAAAAAGTTCAAGAATTCAAATCATCAGTTGTTAATAAATTAACT
    GGTGGTGTTGAAGGCTTACTTAAAGGTAACAAAGTTAACATCGTTAAAGGTGAAGCATAT
    TTCGTAGATAACAATAGCTTACGTGTTATGGACGAAAAGAGCGCACAAACATACAACTTT
    AAAAATGGAATCATTGCAACAGGTTCAAGACCAATTGAAATTCCTAATTTCAAATTCGGT
    AAACGTGTTATCGACTCAACAGGTGCTTTAAACTTACAAGAAGTACCAGGTAAATTAGTT
    GTAGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCA
    GAAGTAACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACA
    CAACCTGTTAAAAAAGGTATGAAAGAAAAAGGTGTTGAAATCGTTACTGAAGCTATGGCT
    AAATCAGCTGAAGAAACAGATAACGGAGTTAAAGTTACTTATGAAGCTAAAGGCGAAGAG
    AAAACAATCGAAGCTGATTATGTATTAGTAACTGTAGGTCGTCGTCCAAACACAGACGAA
    TTAGGCCTAGAAGAATTAGGTGTTAAATTCGCTGACCGTGGATTATTAGAAGTTGATAAA
    CAAAGCCGTACGTCTATCAGCAATATCTATGCAATTGGTGATATCGTTCCAGGTTTACCA
    CTTGCTCACAAAGCTAGCTATGAAGCTAAAGTTGCTGCTGAAGCAATTGATGGTCAAGCT
    GCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTACTGAACCAGAATTAGCTACA
    GTTGGTTATTCAGAAGCGCAAGCTAAAGAAGAAGGTTTAGCAATTAAAGCTTCTAAATTC
    CCATATGCAGCAAATGGTCGTGCATTATCATTAGATGATACTAACGGATTTGTTAAACTT
    ATTACACTTAAAGAAGATGATACTTTAATCGGTGCTCAAGTAGTTGGTACTGGTGCATCA
    GATATTATCTCTGAATTAGGTTTAGCAATTGAAGCTGGTATGAATGCTGAAGATATCGCA
    TTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAAAGCT
    ATCGGATACCCAATCCATACAATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1407

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_0996 [new locus tag: SAUSA300_RS05365 ]
  • symbol: LpdA
  • description: dihydrolipoamide dehydrogenase
  • length: 468
  • theoretical pI: 4.66989
  • theoretical MW: 49437
  • GRAVY: -0.0111111

Function[edit | edit source]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenase Protein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 563.3)
    and 42 more
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 367.9)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 285.4)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 256.3)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 245.6)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 212)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 160)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 114.5)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 63.1)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 55.8)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 55.7)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.2)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.2)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 49.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 41.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 41.6)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 38.8)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 38.2)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 37.8)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 34.1)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 31.8)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 27.6)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 21.3)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 20.5)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.1)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 16.3)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.7)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.2)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 14.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 13.4)
    Metabolism Energy metabolism Amino acids and amines alanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 12.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.2)
    Metabolism Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 11.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 11)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other carotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 10.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 8.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 7.6)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 6.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 4.5)
  • TheSEED:  
    Carbohydrates Central carbohydrate metabolism acinetobacter tca  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
    and 3 more
    Dehydrogenase complexes  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
    Pyruvate metabolism II: acetyl-CoA, acetogenesis from pyruvate  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
    TCA Cycle  Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 242.2)
    and 19 more
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 118.2)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 75)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 45.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 37.7)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 30)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 28.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 28.2)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 26.3)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 21.2)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 20.7)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 18.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 16.2)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 15.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.6)
    Thi4; Thi4 family (PF01946; HMM-score: 13.4)
    no clan defined DUF4150; Domain of unknown function (DUF4150) (PF13665; HMM-score: 12.3)
    NADP_Rossmann (CL0063) Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.3)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 10.6)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021819
    • TAT(Tat/SPI): 0.002475
    • LIPO(Sec/SPII): 0.001894
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVVGDFPIETDTIVIGAGPGGYVAAIRAAQLGQKVTIVEKGNLGGVCLNVGCIPSKALLHASHRFVEAQHSENLGVIAESVSLNFQKVQEFKSSVVNKLTGGVEGLLKGNKVNIVKGEAYFVDNNSLRVMDEKSAQTYNFKNGIIATGSRPIEIPNFKFGKRVIDSTGALNLQEVPGKLVVVGGGYIGSELGTAFANFGSEVTILEGAKDILGGFEKQMTQPVKKGMKEKGVEIVTEAMAKSAEETDNGVKVTYEAKGEEKTIEADYVLVTVGRRPNTDELGLEELGVKFADRGLLEVDKQSRTSISNIYAIGDIVPGLPLAHKASYEAKVAAEAIDGQAAEVDYIGMPAVCFTEPELATVGYSEAQAKEEGLAIKASKFPYAANGRALSLDDTNGFVKLITLKEDDTLIGAQVVGTGASDIISELGLAIEAGMNAEDIALTIHAHPTLGEMTMEAAEKAIGYPIHTM

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]