From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1162 [new locus tag: SAUSA300_RS06290 ]
  • pan locus tag?: SAUPAN003570000
  • symbol: infB
  • pan gene symbol?: infB
  • synonym:
  • product: translation initiation factor IF-2

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1162 [new locus tag: SAUSA300_RS06290 ]
  • symbol: infB
  • product: translation initiation factor IF-2
  • replicon: chromosome
  • strand: +
  • coordinates: 1276382..1278499
  • length: 2118
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    ATGAGTAAACAAAGAATTTACGAATATGCGAAAGAATTAAATCTAAAGAGTAAAGAGATT
    ATAGATGAGTTAAAAAGCATGAATATTGAGGTTTCAAATCATATGCAAGCTTTGGAAGAT
    GACCAAATTAAAGCATTAGATAAAAAGTTCAAAAAAGAACAAAAGAACGACAATAAACAA
    AGCACTCAAAATAATCACCAAAAATCAAACAATCAAAACCAAAATAAAGGGCAACAAAAA
    GATAACAAAAAGAATCAACAACAAAATAATAAAGGCAACAAAGGCAATAAAAAGAATAAT
    AGAAATAATAAGAAAAATAACAAGAATAATAAACCACAAAATCAACCAGCTGCTCCAAAA
    GAAATACCATCAAAAGTGACATATCAAGAAGGTATTACAGTAGGCGAATTTGCGGATAAA
    TTAAATGTTGAATCATCAGAAATTATCAAAAAATTATTCTTACTTGGTATTGTTGCTAAT
    ATCAATCAATCATTAAATCAAGAAACAATCGAATTAATTGCCGATGATTATGGCGTTGAG
    GTTGAAGAAGAAGTTGTGATTAATGAAGAAGACTTATCAATCTATTTCGAAGACGAAAAA
    GATGATCCAGAGGCAATTGAGAGACCAGCAGTTGTAACAATTATGGGACATGTTGACCAT
    GGTAAAACGACTTTATTAGATTCAATTCGTCATACAAAAGTTACAGCAGGTGAAGCAGGC
    GGAATCACTCAACATATTGGTGCATATCAAATTGAAAACGATGGCAAAAAAATCACTTTC
    TTAGATACACCGGGACATGCTGCATTTACAACGATGCGTGCGCGTGGTGCACAAGTAACA
    GATATTACTATTTTAGTAGTAGCAGCTGACGATGGTGTTATGCCACAAACAATTGAAGCA
    ATTAACCATGCTAAAGAAGCAGAAGTACCAATTATTGTTGCAGTAAATAAAATTGATAAA
    CCAACTTCAAATCCTGATCGAGTTATGCAAGAATTAACTGAATATGGTTTAATTCCTGAA
    GATTGGGGCGGCGAAACAATTTTCGTTCCACTTTCTGCATTAAGTGGTGATGGTATCGAC
    GATTTATTAGAAATGATAGGATTAGTTGCAGAAGTTCAAGAACTTAAAGCAAATCCTAAA
    AACCGTGCTGTTGGTACAGTTATCGAAGCTGAATTAGATAAATCACGTGGTCCTTCTGCA
    TCATTATTAGTACAAAACGGTACATTAAATGTTGGTGATGCGATTGTAGTTGGTAATACT
    TACGGCCGTATCCGTGCAATGGTTAATGACTTAGGTCAAAGAATCAAAACGGCTGGTCCA
    TCAACGCCTGTTGAAATTACAGGTATTAATGATGTGCCACAAGCTGGGGATCGCTTTGTT
    GTATTTAGTGATGAAAAACAAGCTCGTCGTATTGGTGAATCAAGACACGAAGCTAGCATT
    ATACAACAACGTCAAGAAAGTAAAAATGTTTCATTAGATAACCTGTTTGAACAAATGAAA
    CAAGGTGAAATGAAAGATTTAAACGTTATTATTAAAGGTGATGTTCAAGGTTCTGTTGAA
    GCTTTAGCTGCATCATTAATGAAAATTGATGTTGAAGGCGTAAATGTTCGTATCATTCAT
    ACAGCGGTTGGTGCAATTAATGAGTCAGACGTGACACTTGCTAATGCCTCAAATGGTATT
    ATCATTGGTTTCAATGTTCGTCCAGACAGTGGTGCAAAACGTGCTGCAGAAGCTGAAAAT
    GTTGATATGCGTTTACACAGAGTTATTTATAATGTTATCGAAGAAATTGAATCAGCGATG
    AAAGGTTTACTTGATCCAGAATTTGAAGAACAAGTTATCGGACAAGCTGAAGTTCGTCAA
    ACATTCAAAGTTTCTAAAGTTGGTACTATTGCTGGATGTTATGTTACTGAAGGTAAAATT
    ACGCGAAATGCTGGTGTACGTATTATTCGTGATGGTATTGTTCAATATGAAGGCGAATTA
    GATACACTTAAACGTTTCAAAGATGATGCTAAGGAAGTTGCAAAAGGTTATGAATGTGGT
    ATTACAATTGAAAACTACAATGACCTTAAAGAAGGCGATGTTATCGAAGCATTTGAAATG
    GTTGAAATTAAGCGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2118

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1162 [new locus tag: SAUSA300_RS06290 ]
  • symbol: InfB
  • description: translation initiation factor IF-2
  • length: 705
  • theoretical pI: 4.83577
  • theoretical MW: 77870.2
  • GRAVY: -0.534894

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Translation factors translation initiation factor IF-2 (TIGR00487; HMM-score: 908.8)
    and 19 more
    Genetic information processing Protein synthesis Translation factors translation initiation factor aIF-2 (TIGR00491; HMM-score: 171.1)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 135.8)
    Genetic information processing Protein synthesis Translation factors selenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 91.2)
    Unknown function General elongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 73.3)
    Cellular processes Cellular processes Adaptations to atypical conditions GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.6)
    Genetic information processing Protein synthesis Translation factors GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.6)
    Signal transduction Regulatory functions Other GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.6)
    Genetic information processing Protein synthesis Translation factors translation elongation factor G (TIGR00484; HMM-score: 52.3)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 52)
    Genetic information processing Protein synthesis Translation factors translation elongation factor Tu (TIGR00485; HMM-score: 48)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 44.8)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 42.4)
    Genetic information processing Protein synthesis Translation factors translation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 42)
    Genetic information processing Protein synthesis Translation factors peptide chain release factor 3 (TIGR00503; HMM-score: 38.8)
    Genetic information processing Protein synthesis Translation factors translation elongation factor aEF-2 (TIGR00490; HMM-score: 32.9)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 27.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 19.6)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 11.9)
    cobaltochelatase subunit (TIGR02442; EC 6.6.1.2; HMM-score: 2.7)
  • TheSEED:  
    Protein Metabolism Protein biosynthesis Translation initiation factors bacterial  Translation initiation factor 2
    and 3 more
    Universal GTPases  Translation initiation factor 2
    CBSS-138119.3.peg.2719  Translation initiation factor 2
    NusA-TFII Cluster  Translation initiation factor 2
  • PFAM:
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 128.9)
    no clan defined IF-2; Translation-initiation factor 2 (PF11987; HMM-score: 128.8)
    HTH (CL0123) IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 110.3)
    and 25 more
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 43.5)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 29)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 25.1)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 24.6)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 17.9)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 16)
    HSP20 (CL0190) PIH1; pre-RNA processing PIH1/Nop17 (PF08190; HMM-score: 14.3)
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 14.1)
    P-loop_NTPase (CL0023) ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13.6)
    no clan defined Spt20; Spt20 family (PF12090; HMM-score: 13.2)
    Tim54; Inner membrane protein import complex subunit Tim54 (PF11711; HMM-score: 12.2)
    Nucleocapsid-N; Nucleocapsid protein N (PF11030; HMM-score: 12)
    PDDEXK (CL0236) eIF-3_zeta; Eukaryotic translation initiation factor 3 subunit 7 (eIF-3) (PF05091; HMM-score: 11.9)
    no clan defined RP-C_C; Replication protein C C-terminal region (PF11800; HMM-score: 11.3)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 11)
    no clan defined DDHD; DDHD domain (PF02862; HMM-score: 9.9)
    Gti1_Pac2; Gti1/Pac2 family (PF09729; HMM-score: 9)
    CDC45; CDC45-like protein (PF02724; HMM-score: 8.4)
    DUF3807; Protein of unknown function (DUF3807) (PF12720; HMM-score: 8.4)
    RRN3; RNA polymerase I specific transcription initiation factor RRN3 (PF05327; HMM-score: 6.7)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 6.6)
    no clan defined Ndc1_Nup; Nucleoporin protein Ndc1-Nup (PF09531; HMM-score: 6)
    Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 5.8)
    FUSC (CL0307) ALMT; Aluminium activated malate transporter (PF11744; HMM-score: 5.8)
    no clan defined GREB1; Gene regulated by oestrogen in breast cancer (PF15782; HMM-score: 3.1)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008286
    • TAT(Tat/SPI): 0.000488
    • LIPO(Sec/SPII): 0.000588
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSKQRIYEYAKELNLKSKEIIDELKSMNIEVSNHMQALEDDQIKALDKKFKKEQKNDNKQSTQNNHQKSNNQNQNKGQQKDNKKNQQQNNKGNKGNKKNNRNNKKNNKNNKPQNQPAAPKEIPSKVTYQEGITVGEFADKLNVESSEIIKKLFLLGIVANINQSLNQETIELIADDYGVEVEEEVVINEEDLSIYFEDEKDDPEAIERPAVVTIMGHVDHGKTTLLDSIRHTKVTAGEAGGITQHIGAYQIENDGKKITFLDTPGHAAFTTMRARGAQVTDITILVVAADDGVMPQTIEAINHAKEAEVPIIVAVNKIDKPTSNPDRVMQELTEYGLIPEDWGGETIFVPLSALSGDGIDDLLEMIGLVAEVQELKANPKNRAVGTVIEAELDKSRGPSASLLVQNGTLNVGDAIVVGNTYGRIRAMVNDLGQRIKTAGPSTPVEITGINDVPQAGDRFVVFSDEKQARRIGESRHEASIIQQRQESKNVSLDNLFEQMKQGEMKDLNVIIKGDVQGSVEALAASLMKIDVEGVNVRIIHTAVGAINESDVTLANASNGIIIGFNVRPDSGAKRAAEAENVDMRLHRVIYNVIEEIESAMKGLLDPEFEEQVIGQAEVRQTFKVSKVGTIAGCYVTEGKITRNAGVRIIRDGIVQYEGELDTLKRFKDDAKEVAKGYECGITIENYNDLKEGDVIEAFEMVEIKR

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]