Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS01910 [old locus tag: EGJ38_000383 ]
- pan locus tag?: SAUPAN002162000
- symbol: EGJ38_RS01910
- pan gene symbol?: psmα1
- synonym: psmA1
- product: phenol-soluble modulin PSM-alpha-1
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS01910 [old locus tag: EGJ38_000383 ]
- symbol: EGJ38_RS01910
- product: phenol-soluble modulin PSM-alpha-1
- replicon: chromosome
- strand: -
- coordinates: 412057..412122
- length: 66
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (412057..412122) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61ATGGGTATCATCGCTGGCATCATTAAAGTTATCAAAAGCTTAATCGAACAATTCACTGGT
AAATAA60
66
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS01910 [old locus tag: EGJ38_000383 ]
- symbol: EGJ38_RS01910
- description: phenol-soluble modulin PSM-alpha-1
- length: 21
- theoretical pI: 10.5069
- theoretical MW: 2259.81
- GRAVY: 0.957143
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM: no clan defined PSMalpha; Phenol-soluble modulin alpha peptide family (PF17063; HMM-score: 46)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0
- Extracellular Score: 0.9998
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.179334
- TAT(Tat/SPI): 0.019163
- LIPO(Sec/SPII): 0.091004
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_014373781 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MGIIAGIIKVIKSLIEQFTGK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: AgrA see EGJ38_000383
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]
Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)