From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 22-FEB-2026

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_RS04220 [old locus tag: EGJ38_000845 ]
  • pan locus tag?: SAUPAN002967000
  • symbol: EGJ38_RS04220
  • pan gene symbol?:
  • synonym:
  • product: RinA family phage transcriptional activator

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_RS04220 [old locus tag: EGJ38_000845 ]
  • symbol: EGJ38_RS04220
  • product: RinA family phage transcriptional activator
  • replicon: chromosome
  • strand: +
  • coordinates: 852228..852650
  • length: 423
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NZ_CM129921 (852228..852650) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGACTAAAAAGAAATACGGATTAAAATTATCAACAGTTCGGAAATTAGAAGACGAGTTG
    TGCGATTATCCTAATTATCATAAACAACTTGAAGATTTAAGAAGTGAAATAATGACACCG
    TGGATTCCAACAGATACAAATATAGGCGGGGAGTTTGTACCATCTAATACATCAAAAACA
    GAAATGGCAGTAACTAATTATCTTTGTAGTATACGAAGAGGTAAAATTCTTGAGTTTAAG
    AGTGCGATTGAACGTATAATCAACACATCAAGTAGGAAAGAACGCGAATTCATTCAAGAG
    TATTATTTTAATAAAAAGACTTTGATTGCGGTTTGTTATGACATACACATCTCTGAAAGT
    ACAGCGCATAGAATCAAGAAGAAAATAGTGTCTAAACTAGCCGAAGAATTAGGAGAATAC
    TAA
    60
    120
    180
    240
    300
    360
    420
    423


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: EGJ38_RS04220 [old locus tag: EGJ38_000845 ]
  • symbol: EGJ38_RS04220
  • description: RinA family phage transcriptional activator
  • length: 140
  • theoretical pI: 9.04808
  • theoretical MW: 16389.8
  • GRAVY: -0.592857

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions phage transcriptional regulator, RinA family (TIGR01636; HMM-score: 201.3)
    Signal transduction Regulatory functions DNA interactions phage transcriptional regulator, RinA family (TIGR01636; HMM-score: 201.3)
    and 9 more
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 29.3)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions phage transcriptional regulator, ArpU family (TIGR01637; HMM-score: 27.2)
    Signal transduction Regulatory functions DNA interactions phage transcriptional regulator, ArpU family (TIGR01637; HMM-score: 27.2)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 21.4)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 21.4)
    RNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 20.5)
    RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 16)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 12.3)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 12.3)
  • TheSEED:
  • PFAM:
    HTH (CL0123) DUF1492; Protein of unknown function (DUF1492) (PF07374; HMM-score: 24.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 22)
    and 1 more
    HTH_Tnp_4; Helix-turn-helix of DDE superfamily endonuclease (PF13613; HMM-score: 14.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.7337
    • Cytoplasmic Membrane Score: 0.0956
    • Cell wall & surface Score: 0.0025
    • Extracellular Score: 0.1682
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.024404
    • TAT(Tat/SPI): 0.00058
    • LIPO(Sec/SPII): 0.002147
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_000162701 NCBI
  • UniProt:

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MTKKKYGLKLSTVRKLEDELCDYPNYHKQLEDLRSEIMTPWIPTDTNIGGEFVPSNTSKTEMAVTNYLCSIRRGKILEFKSAIERIINTSSRKEREFIQEYYFNKKTLIAVCYDIHISESTAHRIKKKIVSKLAEELGEY

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]