Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS08440 [old locus tag: EGJ38_001690 ]
- pan locus tag?: SAUPAN004355000
- symbol: EGJ38_RS08440
- pan gene symbol?: uspA2
- synonym:
- product: universal stress protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS08440 [old locus tag: EGJ38_001690 ]
- symbol: EGJ38_RS08440
- product: universal stress protein
- replicon: chromosome
- strand: +
- coordinates: 1733140..1733553
- length: 414
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (1733140..1733553) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAAAAATATATTACTTGGTGTAGACACTCAGTTAAAAAATGAAAAAGCACTAAAA
GAAGTGTCTAAATTAGCTGGCGAAGGTACAGTCGTAACAGTTTTAAACGCAATCAGCGAA
CAAGATGCTCAAGCATCAATTAAAGCAGGTGTTCATTTAAACAAACTTACTGAAGAACGA
AGCAAGCGATTGGAAAAAACACGCAAAGCTTTAGAAGATTATGGTATTGATTATGACCAA
ATAATTGTTCGTGGTAATGCAAAAGAAGAACTATTAAAACATGCTAATAGCGGTAAATAC
GAAATTGTTGTTTTAAGTAACCGTAAAGCAGAAGACAAAAAGAAATTTGTACTTGGAAGT
GTCAGCCACAAAGTAGCAAAACGTGCGACTATCCCTGTATTAATCGTTAAATAA60
120
180
240
300
360
414
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS08440 [old locus tag: EGJ38_001690 ]
- symbol: EGJ38_RS08440
- description: universal stress protein
- length: 137
- theoretical pI: 10.274
- theoretical MW: 15225.6
- GRAVY: -0.394891
⊟Function[edit | edit source]
- TIGRFAM: Unknown function Enzymes of unknown specificity HAD hydrolase, family IIIA (TIGR01662; HMM-score: 14)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: HUP (CL0039) Usp; Universal stress protein family (PF00582; HMM-score: 86.3)and 5 moreCBM87 (CL0883) CBM87_Agd3; Agd3 CBM87 (PF25116; HMM-score: 19.4)no clan defined YfjL_C; YfjL-like C-terminal domain (PF24911; HMM-score: 14.4)Dak2; DAK2 domain (PF02734; HMM-score: 14.2)PFK (CL0240) DAGK_cat; Diacylglycerol kinase catalytic domain (PF00781; HMM-score: 13.7)TIM_barrel (CL0036) Pterin_bind; Pterin binding enzyme (PF00809; HMM-score: 13.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9756
- Cytoplasmic Membrane Score: 0.0128
- Cell wall & surface Score: 0.0031
- Extracellular Score: 0.0085
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.014314
- TAT(Tat/SPI): 0.000974
- LIPO(Sec/SPII): 0.000837
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000277602 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MYKNILLGVDTQLKNEKALKEVSKLAGEGTVVTVLNAISEQDAQASIKAGVHLNKLTEERSKRLEKTRKALEDYGIDYDQIIVRGNAKEELLKHANSGKYEIVVLSNRKAEDKKKFVLGSVSHKVAKRATIPVLIVK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]