From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1753 [new locus tag: SACOL_RS08970 ]
  • pan locus tag?: SAUPAN004355000
  • symbol: SACOL1753
  • pan gene symbol?: uspA2
  • synonym:
  • product: universal stress protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1753 [new locus tag: SACOL_RS08970 ]
  • symbol: SACOL1753
  • product: universal stress protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1794540..1794953
  • length: 414
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGTATAAAAATATATTACTTGGTGTAGACACTCAGTTAAAAAATGAAAAAGCACTAAAA
    GAAGTGTCTAAATTAGCTGGCGAAGGTACAGTCGTAACAGTTTTAAACGCAATCAGCGAA
    CAAGATGCTCAAGCATCAATTAAAGCAGGTGTTCATTTAAACAAACTTACTGAAGAACGA
    AGCAAGCGATTGGAAAAAACACGCAAAGCTTTAGAAGATTATGGTATTGATTATGACCAA
    ATAATTGTTCGTGGTAATGCAAAAGAAGAACTATTAAAACATGCTAATAGCGGTAAATAC
    GAAATTGTTGTTTTAAGTAACCGTAAAGCAGAAGACAAAAAGAAATTTGTACTTGGAAGT
    GTCAGCCACAAAGTAGCAAAACGTGCGACTATCCCTGTATTAATCGTTAAATAA
    60
    120
    180
    240
    300
    360
    414


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1753 [new locus tag: SACOL_RS08970 ]
  • symbol: SACOL1753
  • description: universal stress protein
  • length: 137
  • theoretical pI: 10.274
  • theoretical MW: 15225.6
  • GRAVY: -0.394891

Function[edit | edit source]

  • TIGRFAM:
    Unknown function Enzymes of unknown specificity HAD hydrolase, family IIIA (TIGR01662; HMM-score: 14)
  • TheSEED  :
    • Universal stress protein family
    Stress Response Stress Response - no subcategory Universal stress protein family  Universal stress protein family
  • PFAM:
    HUP (CL0039) Usp; Universal stress protein family (PF00582; HMM-score: 86.3)
    and 5 more
    CBM87 (CL0883) CBM87_Agd3; Agd3 CBM87 (PF25116; HMM-score: 19.4)
    no clan defined YfjL_C; YfjL-like C-terminal domain (PF24911; HMM-score: 14.4)
    Dak2; DAK2 domain (PF02734; HMM-score: 14.2)
    PFK (CL0240) DAGK_cat; Diacylglycerol kinase catalytic domain (PF00781; HMM-score: 13.7)
    TIM_barrel (CL0036) Pterin_bind; Pterin binding enzyme (PF00809; HMM-score: 13.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9756
    • Cytoplasmic Membrane Score: 0.0128
    • Cell wall & surface Score: 0.0031
    • Extracellular Score: 0.0085
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.014314
    • TAT(Tat/SPI): 0.000974
    • LIPO(Sec/SPII): 0.000837
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MYKNILLGVDTQLKNEKALKEVSKLAGEGTVVTVLNAISEQDAQASIKAGVHLNKLTEERSKRLEKTRKALEDYGIDYDQIIVRGNAKEELLKHANSGKYEIVVLSNRKAEDKKKFVLGSVSHKVAKRATIPVLIVK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 911 [5]
  • interaction partners:
    SACOL2657(arcA)arginine deiminase  [6] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [6] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [6] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [6] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [6] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [6] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [6] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [6] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [6] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [6] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [6] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [6] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [6] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [6] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [6] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [6] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [6] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [6] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [6] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [6] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [6] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [6] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [6] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [6] (data from MRSA252)
    SACOL1118(typA)GTP-binding protein TypA  [6] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [6] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [6] (data from MRSA252)
    SACOL1759universal stress protein  [6] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 16.37 h [7]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 6.18 6.19 6.20 6.21 6.22 6.23 6.24 6.25 6.26 6.27 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]