Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_001069
- pan locus tag?: SAUPAN003329000
- symbol: JSNZ_001069
- pan gene symbol?: —
- synonym:
- product: DUF4064 domain-containing protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_001069
- symbol: JSNZ_001069
- product: DUF4064 domain-containing protein
- replicon: chromosome
- strand: +
- coordinates: 1073671..1074090
- length: 420
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAATAGAAAACCTGAATTAATCATGGCTTGGATTGCAAATAGTATTAGTATTATTTAT
TTATTAGTTATGGGGCTATCCTATTTTTCTTTAAAAAGTGGTAATGCATCACAACGTGAA
GAATTAGCGAAGCAATTATCTCAGAACGGTGGCAAGGTTTCTTTAGATATGCTTCAGACA
ACAATGGGTGCATTAGCAATTATTTTATTAATTTCAACACTTTATGGTATATTTGCGACA
ATTTGTATTAAAGGACGTAGAAAATTATCGATTATACTTTTTGTTATCGCGATAATTGTA
AGTTTGATGGCTCTTAATTTAATTGCAATTGTCTTATGGGTTATCGTGATGATTATGTTG
ATTTCTAAAAAAGAATCAAAAGAAACTACACATAAGGACGATGAGTATATTTATCATTAA60
120
180
240
300
360
420
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_001069
- symbol: JSNZ_001069
- description: DUF4064 domain-containing protein
- length: 139
- theoretical pI: 9.90462
- theoretical MW: 15576.8
- GRAVY: 0.682014
⊟Function[edit | edit source]
- TIGRFAM: Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 15.2)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: TSPAN_4TM-like (CL0347) DUF4064; Protein of unknown function (DUF4064) (PF13273; HMM-score: 78.9)and 11 moreno clan defined DUF6773; Family of unknown function (DUF6773) (PF20563; HMM-score: 18.8)DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 15.9)DUF5993; Family of unknown function (DUF5993) (PF19455; HMM-score: 14.6)TSPAN_4TM-like (CL0347) DUF2569; Protein of unknown function (DUF2569) (PF10754; HMM-score: 11.4)no clan defined Tmemb_9; TMEM9 (PF05434; HMM-score: 11)P2X_receptor; ATP P2X receptor (PF00864; HMM-score: 10.2)EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.6)DUF7670; Domain of unknown function (DUF7670) (PF24709; HMM-score: 8.2)DUF4389; Domain of unknown function (DUF4389) (PF14333; HMM-score: 7.9)DHHC; DHHC palmitoyltransferase (PF01529; HMM-score: 7.1)TSPAN_4TM-like (CL0347) Tetraspanin; Tetraspanin family (PF00335; HMM-score: 6.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 10
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 3
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.7841
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.2158
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.156691
- TAT(Tat/SPI): 0.003661
- LIPO(Sec/SPII): 0.031929
- predicted transmembrane helices (TMHMM): 3
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MNRKPELIMAWIANSISIIYLLVMGLSYFSLKSGNASQREELAKQLSQNGGKVSLDMLQTTMGALAIILLISTLYGIFATICIKGRRKLSIILFVIAIIVSLMALNLIAIVLWVIVMIMLISKKESKETTHKDDEYIYH
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_001068 > JSNZ_001069
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)