From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0955 [new locus tag: SA_RS05405 ]
  • pan locus tag?: SAUPAN003329000
  • symbol: SA0955
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0955 [new locus tag: SA_RS05405 ]
  • symbol: SA0955
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1082015..1082434
  • length: 420
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAATAGAAAACCTGAATTAATCATGGCTTGGATTGCAAATAGTATTAGTATTATTTAT
    TTATTAGTTATGGGGCTATCCTATTTTTCTTTAAAAAGTGGTAATGCATCACAACGTGAA
    GAATTAGCGAAGCAATTATCTCAGAACGGTGGCAATGTTTCTTTAGATATGCTTCAGACA
    ACAATGGGTGCATTAGCAATTATTTTATTAATTTCAACACTTTATGGTATATTTGCGACA
    ATTTGTATTAAAGGGCGTAGAAAATTATCGATTATACTTTTTGTTATCGCGATAATTGTA
    AGTTTGATGGCTCTTAATTTAATTGCAATTGTCTTATGGGTTATCGTGATGATTATGTTG
    ATTTCTAAAAAAGAATCAAAAGAAACTACACATAAGGACGATGAGTATATTTATCATTAA
    60
    120
    180
    240
    300
    360
    420


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0955 [new locus tag: SA_RS05405 ]
  • symbol: SA0955
  • description: hypothetical protein
  • length: 139
  • theoretical pI: 9.71022
  • theoretical MW: 15562.7
  • GRAVY: 0.684892

Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 15.1)
  • TheSEED  :
    • FIG01107917: hypothetical protein
  • PFAM:
    TSPAN_4TM-like (CL0347) DUF4064; Protein of unknown function (DUF4064) (PF13273; HMM-score: 78.6)
    and 11 more
    no clan defined DUF6773; Family of unknown function (DUF6773) (PF20563; HMM-score: 18.2)
    DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 15.2)
    DUF5993; Family of unknown function (DUF5993) (PF19455; HMM-score: 14.6)
    TSPAN_4TM-like (CL0347) DUF2569; Protein of unknown function (DUF2569) (PF10754; HMM-score: 11.7)
    no clan defined Tmemb_9; TMEM9 (PF05434; HMM-score: 11.1)
    P2X_receptor; ATP P2X receptor (PF00864; HMM-score: 10.2)
    DUF7670; Domain of unknown function (DUF7670) (PF24709; HMM-score: 8.3)
    EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.1)
    DUF4389; Domain of unknown function (DUF4389) (PF14333; HMM-score: 8)
    TSPAN_4TM-like (CL0347) Tetraspanin; Tetraspanin family (PF00335; HMM-score: 6.7)
    no clan defined DHHC; DHHC palmitoyltransferase (PF01529; HMM-score: 6.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 3
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.7709
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.229
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.165106
    • TAT(Tat/SPI): 0.003704
    • LIPO(Sec/SPII): 0.032589
  • predicted transmembrane helices (TMHMM): 3

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MNRKPELIMAWIANSISIIYLLVMGLSYFSLKSGNASQREELAKQLSQNGGNVSLDMLQTTMGALAIILLISTLYGIFATICIKGRRKLSIILFVIAIIVSLMALNLIAIVLWVIVMIMLISKKESKETTHKDDEYIYH

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]