From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1113 [new locus tag: SACOL_RS05685 ]
  • pan locus tag?: SAUPAN003329000
  • symbol: SACOL1113
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1113 [new locus tag: SACOL_RS05685 ]
  • symbol: SACOL1113
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1123243..1123662
  • length: 420
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAATAGAAAACCTGAATTAATCATGGCTTGGATTGCAAATAGTATTAGTATTATTTAT
    TTATTAGTTATGGGGCTATCCTATTTTTCTTTAAAAAGTGGTAATGCATCACAACGTGAA
    GAATTAGCGAAGCAATTATCTCAGAACGGTGGCAAGGTTTCTTTAGATATGCTTCAGACA
    ACAATGGGTGCATTAGCAATTATTTTATTAATTTCAACACTTTATGGTATATTTGCGACA
    ATTTGTATTAAAGGACGTAGAAAATTATCGATTATACTTTTTGTTATCGCGATAATTGTA
    AGTTTGATGGCTCTTAATTTAATTGCAATTGTCTTATGGGTTATCGTGATGATTATGTTG
    ATTTCTAAAAAAGAATCAAAAGAAACAACACATAAGGACGATGAGTATATTTATCATTAA
    60
    120
    180
    240
    300
    360
    420

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL1113 [new locus tag: SACOL_RS05685 ]
  • symbol: SACOL1113
  • description: hypothetical protein
  • length: 139
  • theoretical pI: 9.90462
  • theoretical MW: 15576.8
  • GRAVY: 0.682014

⊟Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 15.2)
  • TheSEED  :
    • FIG01107917: hypothetical protein
  • PFAM:
    Tetraspannin (CL0347) DUF4064; Protein of unknown function (DUF4064) (PF13273; HMM-score: 71.6)
    and 13 more
    no clan defined GWT1; GWT1 (PF06423; HMM-score: 17.8)
    DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 15.1)
    Tetraspannin (CL0347) Tetraspannin; Tetraspanin family (PF00335; HMM-score: 13.8)
    no clan defined P2X_receptor; ATP P2X receptor (PF00864; HMM-score: 11.1)
    Ninjurin; Ninjurin (PF04923; HMM-score: 11.1)
    DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 9.6)
    EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.9)
    Tmemb_9; TMEM9 (PF05434; HMM-score: 8)
    DHHC; DHHC palmitoyltransferase (PF01529; HMM-score: 7.4)
    TMEM154; TMEM154 protein family (PF15102; HMM-score: 7.2)
    Sigma_reg_N; Sigma factor regulator N-terminal (PF13800; HMM-score: 6.6)
    Gx_transp (CL0315) ECF_trnsprt; ECF transporter, substrate-specific component (PF12822; HMM-score: 6.4)
    no clan defined PRA1; PRA1 family protein (PF03208; HMM-score: 6.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 3
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.156691
    • TAT(Tat/SPI): 0.003661
    • LIPO(Sec/SPII): 0.031929
  • predicted transmembrane helices (TMHMM): 3

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNRKPELIMAWIANSISIIYLLVMGLSYFSLKSGNASQREELAKQLSQNGGKVSLDMLQTTMGALAIILLISTLYGIFATICIKGRRKLSIILFVIAIIVSLMALNLIAIVLWVIVMIMLISKKESKETTHKDDEYIYH

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Integral membrane [1] [2] [3]
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SACOL1113&oldid=97962"