From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0473 [new locus tag: NWMN_RS02705 ]
  • pan locus tag?: SAUPAN002252000
  • symbol: ftsH
  • pan gene symbol?: ftsH
  • synonym:
  • product: ATP-dependent metalloprotease FtsH

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_0473 [new locus tag: NWMN_RS02705 ]
  • symbol: ftsH
  • product: ATP-dependent metalloprotease FtsH
  • replicon: chromosome
  • strand: +
  • coordinates: 537337..539430
  • length: 2094
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    ATGCAGAAAGCTTTTCGCAATGTGCTAGTTATCGTAATAATAGGCGTTATTATTTTTGGT
    CTATTTTCATATTTAAACGGTAATGGAAATATGCCGAAACAGCTTACATATAATCAATTT
    ACTGAGAAGTTGGAAAAAGGTGACCTTAAAACTTTAGAAATCCAACCACAACAAAATGTC
    TATATGGTAAGTGGTAAAACGAAAAATGATGAAGACTATTCATCAACTATTTTATATAAC
    AACGAAAAAGAATTACAAAAAATTACTGATGCTGCTAAAAAGCAAAACGGTGTAAAATTA
    ACGATTAAAGAAGAAGAAAAACAAAGTGTCTTTGTGAGTATACTTTCAACATTAATTCCA
    GTTGTAGTCATAGCGTTATTATTTATTTTCTTCCTAAGCCAAGCACAAGGTGGCGGTAGT
    GGCGGTCGTATGATGAACTTTGGTAAATCTAAAGCAAAAATGTACGATAATAATAAACGT
    CGTGTTCGTTTCTCTGATGTAGCAGGGGCAGATGAAGAAAAACAAGAATTAATTGAAATT
    GTTGATTTCTTGAAAGATAATAAAAAATTCAAAGAAATGGGATCTAGGATTCCTAAAGGT
    GTCTTACTTGTTGGACCTCCAGGTACTGGTAAAACATTACTTGCTAGAGCGGTTGCAGGT
    GAAGCTGGCGCACCATTCTTCTCTATTAGTGGTTCAGACTTTGTAGAGATGTTTGTTGGT
    GTTGGTGCGAGCCGTGTTCGTGACTTATTCGATAATGCTAAGAAAAACGCGCCTTGTATC
    ATCTTTATCGATGAGATTGATGCTGTTGGTCGTCAACGTGGTGCAGGTGTTGGTGGCGGT
    CATGATGAACGTGAACAAACCCTAAACCAATTATTAGTTGAAATGGATGGTTTCGGTGAA
    AATGAAGGTATCATTATGATAGCTGCTACAAACCGTCCTGATATCCTTGACCCAGCCTTA
    TTACGTCCAGGTCGTTTTGATAGACAAATTCAAGTTGGTCGTCCAGATGTGAAAGGCCGT
    GAAGCAATTCTTCATGTTCATGCTAAAAACAAACCACTTGATGAAACGGTTGATTTAAAA
    GCAATTTCACAACGTACACCTGGTTTCTCAGGTGCTGATTTAGAGAACTTATTAAATGAA
    GCATCTTTAATTGCTGTACGTGAAGGTAAAAAGAAAATTGACATGAGAGATATCGAAGAG
    GCAACGGATAGAGTTATAGCCGGACCTGCTAAGAAATCTCGAGTTATTTCTAAGAAAGAA
    CGTAATATTGTTGCTCATCACGAAGCTGGTCATACAATTATCGGTATGGTACTTGATGAG
    GCAGAAGTAGTGCATAAAGTTACTATTGTTCCACGTGGACAAGCAGGTGGTTATGCAATG
    ATGCTACCTAAACAAGATCGTTTCTTAATGACTGAACAAGAGTTATTAGATAAAATCTGT
    GGTTTACTTGGTGGACGTGTATCAGAAGATATTAACTTTAACGAAGTATCAACAGGTGCT
    TCAAATGACTTCGAACGTGCAACACAAATCGCACGCTCAATGGTTACGCAATATGGTATG
    AGTAAAAAATTAGGACCATTACAGTTCGGTCATAGCAATGGTCAAGTATTCTTAGGTAAA
    GATATGCAAGGTGAGCCTAATTATTCAAGCCAAATCGCATATGAAATTGATAAAGAAGTT
    CAACGAATCGTTAAAGAACAATACGAACGTTGTAAACAAATTTTATTAGAGCACAAAGAA
    CAATTAATTTTAATTGCTGAAACATTATTAACAGAAGAAACATTAGTTGCTGAACAAATT
    CAATCATTATTCTACGAAGGTAAATTACCTGAAATTGATTATGATGCAGCTAAAGTTGTT
    AAAGATGAAGATTCTGAATTTAATGATGGTAAATTCGGTAAATCTTATGAAGAGATTCGT
    AAAGAGCAATTAGAAGATGGACAACGTGACGAAAGTGAAGATCGTAAAGAAGAAAAAGAT
    ATTGCTGAGGATAAAAAAGAAGCTGATAAATCTGATGAAAAAGATGAACCAGCACATCAA
    CAAGCCCCAAATATCGAAAAACCTTACGATCCAAATCACCCAGACAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2094

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_0473 [new locus tag: NWMN_RS02705 ]
  • symbol: FtsH
  • description: ATP-dependent metalloprotease FtsH
  • length: 697
  • theoretical pI: 5.17894
  • theoretical MW: 77783.9
  • GRAVY: -0.508178

Function[edit | edit source]

  • reaction:
    EC 3.4.24.-?  ExPASy
  • TIGRFAM:
    Cellular processes Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 791.5)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 791.5)
    and 19 more
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 273.6)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 259.8)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides proteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 143.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 28.8)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 26.8)
    Cellular processes Cellular processes Sporulation and germination stage V sporulation protein K (TIGR02881; HMM-score: 23.5)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 23.2)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 23.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 21.1)
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 21)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 21)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 20.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 17.2)
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 15.7)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 13.7)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 13)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 12)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking preprotein translocase, YajC subunit (TIGR00739; HMM-score: 11)
    MAST domain (TIGR04204; HMM-score: 9)
  • TheSEED:  
    Bacterial Cell Division  Cell division protein FtsH (EC 3.4.24.-)
    and 2 more
    Cell division-ribosomal stress proteins cluster  Cell division protein FtsH (EC 3.4.24.-)
    RP Bacterial Cell Division  Cell division protein FtsH (EC 3.4.24.-)
  • PFAM:
    Peptidase_MA (CL0126) Peptidase_M41; Peptidase family M41 (PF01434; HMM-score: 279.8)
    and 17 more
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 158.6)
    no clan defined FtsH_ext; FtsH Extracellular (PF06480; HMM-score: 52.9)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 23.6)
    AAA_22; AAA domain (PF13401; HMM-score: 23.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 22.6)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 20.7)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 20)
    AAA_33; AAA domain (PF13671; HMM-score: 17.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 14.3)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.7)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 13.4)
    AAA_18; AAA domain (PF13238; HMM-score: 12.8)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 12.6)
    AAA_28; AAA domain (PF13521; HMM-score: 11.3)
    no clan defined ODV-E18; Occlusion-derived virus envelope protein ODV-E18 (PF10717; HMM-score: 10.7)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 5.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_1326(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.41756
    • TAT(Tat/SPI): 0.00127
    • LIPO(Sec/SPII): 0.095953
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MQKAFRNVLVIVIIGVIIFGLFSYLNGNGNMPKQLTYNQFTEKLEKGDLKTLEIQPQQNVYMVSGKTKNDEDYSSTILYNNEKELQKITDAAKKQNGVKLTIKEEEKQSVFVSILSTLIPVVVIALLFIFFLSQAQGGGSGGRMMNFGKSKAKMYDNNKRRVRFSDVAGADEEKQELIEIVDFLKDNKKFKEMGSRIPKGVLLVGPPGTGKTLLARAVAGEAGAPFFSISGSDFVEMFVGVGASRVRDLFDNAKKNAPCIIFIDEIDAVGRQRGAGVGGGHDEREQTLNQLLVEMDGFGENEGIIMIAATNRPDILDPALLRPGRFDRQIQVGRPDVKGREAILHVHAKNKPLDETVDLKAISQRTPGFSGADLENLLNEASLIAVREGKKKIDMRDIEEATDRVIAGPAKKSRVISKKERNIVAHHEAGHTIIGMVLDEAEVVHKVTIVPRGQAGGYAMMLPKQDRFLMTEQELLDKICGLLGGRVSEDINFNEVSTGASNDFERATQIARSMVTQYGMSKKLGPLQFGHSNGQVFLGKDMQGEPNYSSQIAYEIDKEVQRIVKEQYERCKQILLEHKEQLILIAETLLTEETLVAEQIQSLFYEGKLPEIDYDAAKVVKDEDSEFNDGKFGKSYEEIRKEQLEDGQRDESEDRKEEKDIAEDKKEADKSDEKDEPAHQQAPNIEKPYDPNHPDNK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • ftsH no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]