From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1144 [new locus tag: NWMN_RS06455 ]
  • pan locus tag?: SAUPAN003521000
  • symbol: smc
  • pan gene symbol?: smc
  • synonym:
  • product: chromosome segregation SMC protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1144 [new locus tag: NWMN_RS06455 ]
  • symbol: smc
  • product: chromosome segregation SMC protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1252729..1256295
  • length: 3567
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    ATGGTTTATTTAAAATCAATAGATGCCATTGGATTTAAGTCTTTTGCAGATCAAACCAAT
    GTTCAATTCGATAAAGGTGTAACTGCAATTGTTGGTCCAAATGGAAGCGGTAAAAGTAAT
    ATTACAGATGCTATTAAATGGGTGTTGGGTGAACAATCGGCTAAATCATTACGTGGCTCA
    AAAATGGAAGATATTATCTTCTCAGGTGCAGAACATCGCAAAGCTCAAAATTATGCTGAA
    GTACAGTTAAGATTAGATAATCATTCTAAAAAGCTCAGTGTTGATGAAAACGAAGTTATT
    GTAACAAGAAGATTGTATCGAAGTGGTGAAAGTGAGTACTACATAAATAATGACCGTGCA
    AGATTAAAAGATATTGCCGATTTATTTTTAGATTCTGGATTGGGAAAAGAAGCGTATAGC
    ATTATCTCGCAAGGTAGAGTTGATGAAATACTAAATGCTAAACCAATTGATAGACGTCAA
    ATTATTGAAGAATCGGCTGGTGTACTTAAATATAAAAAACGTAAGGCTGAATCATTAAAT
    AAACTTGACCAAACAGAAGATAATTTAACGAGAGTAGAAGACATTTTATATGATTTGGAA
    GGTCGCGTAGAACCTCTAAAAGAGGAGGCAGCTATAGCTAAAGAATATAAGACACTTTCA
    CATCAAATGAAACATAGTGACATTGTAGTTACAGTGCACGATATTGATCAATATACAAAT
    GACAATAGACAATTAGATCAACGTTTAAATGATTTACAAGGCCAACAAGCAAATAAAGAA
    GCTGACAAGCAACGTTTAAGCCAACAAATTCAACAATATAAAGGTAAACGTCATCAACTT
    GATAATGATGTTGAATCGCTTAATTATCAATTAGTAAAAGCTACGGAAGCCTTTGAAAAA
    TATACGGGACAATTAAATGTTTTGGAAGAACGTAAGAAAAATCAATCTGAAACAAATGCA
    CGATATGAAGAAGAACAAGAAAATTTAATGGAGCTTTTAGAAAATATATCAAATGAGATT
    TCTGAAGCTCAAGATACTTATAAGTCTCTGAAAAGTAAACAAAAAGAACTCAATGCTGTC
    ATTCGTGAACTTGAAGAACAACTATATGTTTCAGACGAAGCACATGATGAAAAATTGGAA
    GAAATTAAAAACGAATACTATACATTAATGTCAGAGCAATCAGATGTTAACAATGATATT
    CGTTTTTTAAAGCATACTATAGAAGAGAATGAGGCTAAAAAATCAAGACTAGATTCTCGA
    TTAGTTGAAGTTTTTGAGCAATTGAAAGATATTCAGGGTCAAATAAAAACGACAAAAAAA
    GAATATCAACAGACCAACAAAGAACTTTCTGCTGTAGATAAAGAAATTAAAAATATAGAA
    AAAGACCTCACTGATACAAAAAAAGCACAAAATGAATACGAAGAGAAATTGTATCAAGCA
    TATCGATATACCGAAAAAATGAAAACACGTATTGATAGTTTGGCAACGCAAGAGGAAGAA
    TATACTTATTTTTTCAATGGCGTCAAACATATTTTGAAAGCTAAAAATAAAGAATTAAAG
    GGTATTTATGGTGCAGTTGCGGAAATTATTGATGTGCCATCTAAATTAACTCAGGCAATT
    GAAACAGCATTAGGTGCTTCATTACAACATGTCATTGTAGATTCAGAAAAAGATGGACGC
    CAGGCTATTCAATTTTTAAAAGAACGTAATTTAGGTCGTGCGACGTTTTTACCATTAAAT
    GTTATACAGAGTAGAGTGGTAGCGACTGATATTAAATCTATTGCTAAAGAGGCAAACGGA
    TTTATTAGTATCGCTTCGGAAGCAGTTAAAGTAGCACCAGAATATCAAAATATTATCGGG
    AATTTATTAGGTAATACGATTATCGTTGATCATTTAAAGCATGCAAATGAATTGGCACGT
    GCGATTAAATATCGAACTCGTATTGTTACTTTGGAAGGTGATATTGTAAATCCTGGTGGT
    TCTATGACTGGTGGTGGCGCTCGTAAGTCAAAAAGTATTCTGTCTCAAAAAGACGAGTTG
    ACAACAATGAGACACCAATTAGAAGATTACTTGCGTCAAACAGAATCATTTGAACAACAA
    TTTAAAGAGTTGAAGATAAAAAGTGATCAATTAAGTGAACTGTATTTTGAAAAAAGTCAA
    AAGCATAATACACTTAAAGAGCAAGTGCATCATTTTGAAATGGAGCTCGATAGATTAACT
    ACACAAGAAACACAAATAAAAAATGATCATGAAGAATTCGAATTTGAAAAAAATGATGGT
    TATACGAGTGACAAAAGTCGACAAACTTTGAGTGAAAAAGAAACTTATCTAGAAAGTATT
    AAAGCATCTTTAAAACGACTAGAAGATGAAATTGAACGCTACACAAAACTTTCTAAAGAA
    GGTAAGGAAAGCGTTACTAAAACACAACAAACCTTACATCAGAAACAATCTGATCTTGCT
    GTGGTTAAAGAGCGTATTAAAACACAACAACAGACAATAGATCGATTAAATAATCAAAAT
    CAACAAACTAAACATCAATTAAAAGATGTTAAAGAAAAAATTGCATTCTTTAATTCGGAT
    GAAGTGATGGGCGAACAAGCTTTTCAAAATATTAAAGATCAAATTAATGGTCAACAAGAA
    ACGAGAACACGCTTATCAGATGAATTAGATAAATTGAAACAACAACGTATTGAGTTGAAT
    GAACAAATCGATGCGCAAGAAGCTAAACTACAAGTTTGTCACCAAGATATTTTAGCTATC
    GAAAATCACTACCAAGATATTAAAGCTGAACAATCAAAGCTAGATGTATTAATTCATCAT
    GCGATAGATCATTTAAATGATGAATATCAATTGACTGTTGAACGTGCGAAATCTGAATAT
    ACGAGTGATGAATCGATTGACGCATTACGTAAAAAAGTTAAGTTAATGAAGATGTCGATT
    GATGAACTAGGTCCTGTAAACTTAAATGCAATTGAACAATTTGAAGAGTTAAATGAACGT
    TATACATTTTTAAGTGAACAACGTACAGATCTTCGTAAAGCTAAAGAAACATTAGAGCAA
    ATTATAAGTGAAATGGATCAAGAGGTTACTGAAAGATTTAAAGAAACTTTCCATGCTATT
    CAAGGACATTTTACAGCTGTGTTCAAACAATTGTTTGGTGGAGGCGATGCAGAATTGCAA
    TTAACTGAAGCCGATTATTTAACAGCTGGTATTGATATTGTGGTACAACCACCGGGTAAA
    AAGTTGCAACATTTATCGTTACTGAGTGGTGGTGAGCGTGCATTAACTGCTATTGCTTTA
    CTATTTGCAATTTTAAAAGTAAGATCTGCACCTTTTGTTATATTAGATGAGGTTGAAGCT
    GCACTAGATGAAGCAAATGTTATTAGATACGCAAAATATTTAAATGAGTTATCAGACGAA
    ACACAATTCATTGTTATTACACACCGTAAAGGAACAATGGAATTTGCAGATAGGTTATAC
    GGTGTAACAATGCAAGAATCAGGTGTTACTAAACTTGTGAGTGTGAATTTAAATACAATA
    GATGATGTGTTGAAGGAGGAGCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3567

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_1144 [new locus tag: NWMN_RS06455 ]
  • symbol: Smc
  • description: chromosome segregation SMC protein
  • length: 1188
  • theoretical pI: 5.14611
  • theoretical MW: 136748
  • GRAVY: -0.759428

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 1104)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 1104)
    and 24 more
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 659.4)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 659.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair protein RecN (TIGR00634; HMM-score: 55.8)
    helix-rich protein (TIGR04523; HMM-score: 44.7)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 34.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 32)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 32)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 31.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 30.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 29.8)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 27.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 27.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 27.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 26.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 24.3)
    SH3 domain protein (TIGR04211; HMM-score: 21.9)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 18.4)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 17.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 14)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 13.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12.6)
    Genetic information processing DNA metabolism Restriction/modification DNA sulfur modification protein DndD (TIGR03185; HMM-score: 10.9)
    Hypothetical proteins Conserved TIGR02680 family protein (TIGR02680; HMM-score: 7.5)
  • TheSEED:  
    Cell Division and Cell Cycle Cell Division and Cell Cycle - no subcategory Two cell division clusters relating to chromosome partitioning  Chromosome partition protein smc
    and 1 more
    Clustering-based subsystems Fatty acid metabolic cluster COG1399  Chromosome partition protein smc
  • PFAM:
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 208.9)
    and 13 more
    no clan defined SMC_hinge; SMC proteins Flexible Hinge Domain (PF06470; HMM-score: 103.1)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 73.6)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 47.7)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 34.7)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 29.7)
    T3SS-Chaperone (CL0419) FliJ; Flagellar FliJ protein (PF02050; HMM-score: 16.1)
    VPS23_C (CL0596) Mod_r; Modifier of rudimentary (Mod(r)) protein (PF07200; HMM-score: 15.9)
    P-loop_NTPase (CL0023) SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 13.5)
    Reo_sigma (CL0326) Reo_sigmaC; Reovirus sigma C capsid protein (PF04582; HMM-score: 13.2)
    no clan defined DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 9.5)
    FUSC (CL0307) FUSC; Fusaric acid resistance protein family (PF04632; HMM-score: 8.6)
    no clan defined DUF730; Protein of unknown function (DUF730) (PF05325; HMM-score: 8.2)
    P-loop_NTPase (CL0023) AAA_13; AAA domain (PF13166; HMM-score: 5.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.012867
    • TAT(Tat/SPI): 0.00074
    • LIPO(Sec/SPII): 0.001805
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVYLKSIDAIGFKSFADQTNVQFDKGVTAIVGPNGSGKSNITDAIKWVLGEQSAKSLRGSKMEDIIFSGAEHRKAQNYAEVQLRLDNHSKKLSVDENEVIVTRRLYRSGESEYYINNDRARLKDIADLFLDSGLGKEAYSIISQGRVDEILNAKPIDRRQIIEESAGVLKYKKRKAESLNKLDQTEDNLTRVEDILYDLEGRVEPLKEEAAIAKEYKTLSHQMKHSDIVVTVHDIDQYTNDNRQLDQRLNDLQGQQANKEADKQRLSQQIQQYKGKRHQLDNDVESLNYQLVKATEAFEKYTGQLNVLEERKKNQSETNARYEEEQENLMELLENISNEISEAQDTYKSLKSKQKELNAVIRELEEQLYVSDEAHDEKLEEIKNEYYTLMSEQSDVNNDIRFLKHTIEENEAKKSRLDSRLVEVFEQLKDIQGQIKTTKKEYQQTNKELSAVDKEIKNIEKDLTDTKKAQNEYEEKLYQAYRYTEKMKTRIDSLATQEEEYTYFFNGVKHILKAKNKELKGIYGAVAEIIDVPSKLTQAIETALGASLQHVIVDSEKDGRQAIQFLKERNLGRATFLPLNVIQSRVVATDIKSIAKEANGFISIASEAVKVAPEYQNIIGNLLGNTIIVDHLKHANELARAIKYRTRIVTLEGDIVNPGGSMTGGGARKSKSILSQKDELTTMRHQLEDYLRQTESFEQQFKELKIKSDQLSELYFEKSQKHNTLKEQVHHFEMELDRLTTQETQIKNDHEEFEFEKNDGYTSDKSRQTLSEKETYLESIKASLKRLEDEIERYTKLSKEGKESVTKTQQTLHQKQSDLAVVKERIKTQQQTIDRLNNQNQQTKHQLKDVKEKIAFFNSDEVMGEQAFQNIKDQINGQQETRTRLSDELDKLKQQRIELNEQIDAQEAKLQVCHQDILAIENHYQDIKAEQSKLDVLIHHAIDHLNDEYQLTVERAKSEYTSDESIDALRKKVKLMKMSIDELGPVNLNAIEQFEELNERYTFLSEQRTDLRKAKETLEQIISEMDQEVTERFKETFHAIQGHFTAVFKQLFGGGDAELQLTEADYLTAGIDIVVQPPGKKLQHLSLLSGGERALTAIALLFAILKVRSAPFVILDEVEAALDEANVIRYAKYLNELSDETQFIVITHRKGTMEFADRLYGVTMQESGVTKLVSVNLNTIDDVLKEEQ

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]