From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2090 [new locus tag: NWMN_RS12100 ]
  • pan locus tag?: SAUPAN005582000
  • symbol: NWMN_2090
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_2090 [new locus tag: NWMN_RS12100 ]
  • symbol: NWMN_2090
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2327232..2328233
  • length: 1002
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAAAATGATAGGATTTGAGAAGCCCTTTAAATTGGAAGAAGGAAATTTATTTAAAGTA
    TACGAACAAAGAAAGCCAACGCCAGAAAACGATGATATCTTAGTCAAAGTAAATAGCATT
    AGTGTAAATCCTGTAGATACAAAGCAACGACAAATGGAAGTCACTCAAGCACCTCGTGTA
    CTTGGGTTTGATGCTATTGGTACTGTTGAAGCTATCGGACCAGACGTTACATTATTTAGT
    CCGGGTGACGTTGTATTTTATGCTGGATCGCCAAATAGACAAGGATCAAATGCGACATAT
    CAATTGGTGTCAGAAGCTATAGTTGCAAAAGCACCACACAACATAAGTGCTAATGAAGCG
    GTTAGTCTACCGCTAACTGGTATTACGGCATATGAAACGTTTTTTGATACATTTAAAATT
    TCTACGAATCCTGCTGAAAACGAAGGGAAGTCTGTCTTAATCATTAATGGTGCCGGTGGT
    GTAGGCAGTATAGCCACTCAAATTGCTAAACGGTATGGTTTAACTGTCATTACAACAGCA
    TCACGACAAGAAACAACAGAGTGGTGTGAAAAGATGGGCGCAGATATCGTATTGAATCAT
    AAAGAGGATTTAGTGCGTCAATTTAAAGAAATTCCATTAGTAGATTATATATTTTGCACC
    TATAATACAGACTTGTATTACAATACTATGATTGAACTGATAAAACCATTAGGGCATATT
    ACGACTATCGTAGCTTTTAATGAAGATCAAGATTTAAATGCATTAAAATTAAAAAGTATA
    ACATTTACACATGAATTTATGTTTGCGCGTCCAATTCATCGAACGCCTGATATGATTAAA
    CAACATGAGTATTTAGAAGATATTACGAAAAATATAGAATCAGGGCATTACCAACCAACA
    ACGACACAAGTTTTTGAAGGTTTATCACCTGAAAACTTATATCAAGCACATCAATTGTTG
    GAAAAACAATCAATGATTGGAAAATTAGTAATTAATATATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1002

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_2090 [new locus tag: NWMN_RS12100 ]
  • symbol: NWMN_2090
  • description: hypothetical protein
  • length: 333
  • theoretical pI: 5.09697
  • theoretical MW: 37269.2
  • GRAVY: -0.221922

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Energy metabolism Fermentation zinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 326.8)
    and 14 more
    Unknown function Enzymes of unknown specificity putative NAD(P)H quinone oxidoreductase, PIG3 family (TIGR02824; HMM-score: 138.3)
    Unknown function Enzymes of unknown specificity putative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 70.4)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 68.9)
    Metabolism Energy metabolism Amino acids and amines L-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 39.1)
    Cellular processes Cellular processes Detoxification S-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 38.1)
    leukotriene B4 12-hydroxydehydrogenase/15-oxo-prostaglandin 13-reductase (TIGR02825; EC 1.3.1.48,1.3.1.74; HMM-score: 36.9)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 32.6)
    Unknown function Enzymes of unknown specificity NDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 32.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll chlorophyll synthesis pathway protein BchC (TIGR01202; HMM-score: 28.5)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 20)
    Cellular processes Cellular processes Detoxification S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 19.7)
    Metabolism Energy metabolism Fermentation S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 19.7)
    Metabolism Energy metabolism Fermentation zinc-binding alcohol dehydrogenase family protein (TIGR02822; EC 1.-.-.-; HMM-score: 18.9)
    acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 14.8)
  • TheSEED:  
    Bifunctional protein: zinc-containing alcohol dehydrogenase
    and 2 more
    quinone oxidoreductase ( NADPH:quinone reductase) (EC 1.1.1.-)
    Similar to arginate lyase
  • PFAM:
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 54.2)
    ADH_zinc_N_2; Zinc-binding dehydrogenase (PF13602; HMM-score: 49.2)
    and 4 more
    GroES (CL0296) ADH_N; Alcohol dehydrogenase GroES-like domain (PF08240; HMM-score: 29.4)
    NADP_Rossmann (CL0063) AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 17.7)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 13.1)
    CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 11.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006295
    • TAT(Tat/SPI): 0.000259
    • LIPO(Sec/SPII): 0.000768
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKMIGFEKPFKLEEGNLFKVYEQRKPTPENDDILVKVNSISVNPVDTKQRQMEVTQAPRVLGFDAIGTVEAIGPDVTLFSPGDVVFYAGSPNRQGSNATYQLVSEAIVAKAPHNISANEAVSLPLTGITAYETFFDTFKISTNPAENEGKSVLIINGAGGVGSIATQIAKRYGLTVITTASRQETTEWCEKMGADIVLNHKEDLVRQFKEIPLVDYIFCTYNTDLYYNTMIELIKPLGHITTIVAFNEDQDLNALKLKSITFTHEFMFARPIHRTPDMIKQHEYLEDITKNIESGHYQPTTTQVFEGLSPENLYQAHQLLEKQSMIGKLVINI

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • NWMN_2090 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]