From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2439 [new locus tag: NWMN_RS14015 ]
  • pan locus tag?: SAUPAN006197000
  • symbol: cidB
  • pan gene symbol?: cidB
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_2439 [new locus tag: NWMN_RS14015 ]
  • symbol: cidB
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2682470..2683159
  • length: 690
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATGATTACGTGCAAGCCTTATTAATGATTTTGTTGACTGTCGTTTTATATTATTTC
    GCTAAAAGGTTACAACAAAAATATCCGAACCCATTTTTGAATCCAGCATTAATTGCATCT
    TTAGGAATTATTTTTGTCTTACTTATCTTTGGAATTAGTTATAACGGGTATATGAAAGGT
    GGCAGTTGGATCAACCATATTTTAAACGCAACGGTCGTATGTTTAGCGTACCCACTTTAT
    AAAAATAGAGAGAAAATTAAAGACAATGTCTCTATCATTTTTGCAAGTGTATTAACTGGC
    GTCATGCTGAATTTCATGTTAGTGTTCTTAACACTTAAAGCATTTGGCTATTCTAAAGAC
    GTCATTGTAACGTTATTGCCCCGATCTATAACAGCCGCAGTAGGTATCGAAGTGTCACAT
    GAACTAGGTGGTACAGATACGATGACCGTACTTTTTATTATCACAACGGGTTTAATCGGT
    AGTATTTTAGGTTCGATGTTATTAAGATTTGGAAGATTTGAATCTTCTATCGCCAAAGGA
    TTAACGTATGGGAATGCGTCACATGCATTTGGCACAGCTAAAGCACTAGAAATGGATATT
    GAATCCGGTGCATTTAGTTCAATTGGGATGATTTTAACTGCAGTTATTAGTTCAGTGTTA
    ATACCTGTTCTAATTTTATTATTCTATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    690

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_2439 [new locus tag: NWMN_RS14015 ]
  • symbol: CidB
  • description: hypothetical protein
  • length: 229
  • theoretical pI: 9.40732
  • theoretical MW: 25011.7
  • GRAVY: 0.851528

Function[edit | edit source]

  • TIGRFAM:
    Hypothetical proteins Conserved TIGR00659 family protein (TIGR00659; HMM-score: 192.1)
  • TheSEED:  
    Regulation and Cell signaling Programmed Cell Death and Toxin-antitoxin Systems Murein hydrolase regulation and cell death  CidA-associated membrane protein CidB
  • PFAM:
    no clan defined LrgB; LrgB-like family (PF04172; HMM-score: 232.6)
    and 4 more
    RETICULATA-like; Protein RETICULATA-related (PF11891; HMM-score: 12.8)
    DUF3290; Protein of unknown function (DUF3290) (PF11694; HMM-score: 10.7)
    Thioredoxin (CL0172) OST3_OST6; OST3 / OST6 family, transporter family (PF04756; HMM-score: 7.6)
    no clan defined DUF3671; Protein of unknown function (PF12420; HMM-score: 7.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002069
    • TAT(Tat/SPI): 0.000164
    • LIPO(Sec/SPII): 0.006048
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNDYVQALLMILLTVVLYYFAKRLQQKYPNPFLNPALIASLGIIFVLLIFGISYNGYMKGGSWINHILNATVVCLAYPLYKNREKIKDNVSIIFASVLTGVMLNFMLVFLTLKAFGYSKDVIVTLLPRSITAAVGIEVSHELGGTDTMTVLFIITTGLIGSILGSMLLRFGRFESSIAKGLTYGNASHAFGTAKALEMDIESGAFSSIGMILTAVISSVLIPVLILLFY

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB (activation) regulon
    SigB(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation [1] [2]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  2. Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J Bacteriol: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]