From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS09570 [old locus tag: NWMN_1703 ]
  • pan locus tag?: SAUPAN004559000
  • symbol: NWMN_RS09570
  • pan gene symbol?: splD
  • synonym:
  • product: serine protease SplD

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS09570 [old locus tag: NWMN_1703 ]
  • symbol: NWMN_RS09570
  • product: serine protease SplD
  • replicon: chromosome
  • strand: -
  • coordinates: 1901029..1901748
  • length: 720
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_009641 (1901029..1901748) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATAAAAATATAATCATCAAAAGTATTGCGGCATTGACGATTTTAACATCAATAACT
    GGTGTCGGCACAACAGTGGTTGATGGTATTCAACAAACAGCCAAAGCAGAAAATAGTGTG
    AAATTAATTACCAACACGAATGTTGCACCATACAGTGGTGTTACATGGATGGGCGCTGGA
    ACAGGATTTGTAGTTGGGAATCATACAATCATTACCAATAAACATGTTACTTATCACATG
    AAAGTCGGTGATGAAATCAAAGCACATCCTAATGGTTTTTATAATAACGGTGGTGGACTT
    TATAAAGTTACTAAGATTGTAGATTATCCTGGTAAAGAAGATATTGCGGTCGTACAAGTT
    GAAGAAAAATCAACGCAACCAAAAGGTAGAAAATTCAAAGATTTCACTAGCAAATTTAAT
    ATAGCATCAGAAGCTAAAGAAAATGAACCTATATCAGTCATTGGTTATCCAAATCCTAAT
    GGAAATAAACTACAAATGTATGAATCAACTGGTAAAGTACTATCAGTGAATGGAAATATA
    GTGACATCTGATGCGGTTGTCCAACCTGGCAGCTCTGGTTCACCTATATTAAATAGTAAG
    CGAGAAGCAATTGGTGTTATGTATGCTAGTGATAAACCAACAGGTGAAAGTACAAGGTCA
    TTTGCTGTTTATTTCTCTCCTGAAATTAAGAAATTTATTGCAGATAATTTAGATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720

Protein[edit | edit source]

Protein Data Bank: 4INK
Protein Data Bank: 4INL

General[edit | edit source]

  • locus tag: NWMN_RS09570 [old locus tag: NWMN_1703 ]
  • symbol: NWMN_RS09570
  • description: serine protease SplD
  • length: 239
  • theoretical pI: 9.67665
  • theoretical MW: 25678
  • GRAVY: -0.272803

Function[edit | edit source]

  • reaction:
    EC 3.4.21.-?  ExPASy
  • TIGRFAM:
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides peptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 26.6)
    Genetic information processing Protein fate Protein folding and stabilization peptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 26.6)
    and 1 more
    Genetic information processing Transcription Degradation of RNA inner membrane protein YhjD (TIGR00766; HMM-score: 10.7)
  • TheSEED:
  • PFAM:
    Peptidase_PA (CL0124) Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 63.7)
    Trypsin; Trypsin (PF00089; HMM-score: 54.7)
    and 4 more
    Peptidase_S7; Peptidase S7, Flavivirus NS3 serine protease (PF00949; HMM-score: 26.4)
    Peptidase_S29; Hepatitis C virus NS3 protease (PF02907; HMM-score: 14.4)
    DUF31; Putative peptidase (DUF31) (PF01732; HMM-score: 13.6)
    Peptidase_S46; Peptidase S46 (PF10459; HMM-score: 11)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.73
    • Internal Helices: 2
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 36 aa
    • SP(Sec/SPI): 0.92206
    • TAT(Tat/SPI): 0.005592
    • LIPO(Sec/SPII): 0.024453
    • Cleavage Site: CS pos: 36-37. AKA-EN. Pr: 0.7552
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

  • GI: 446961448 NCBI
  • RefSeq: WP_001038704 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MNKNIIIKSIAALTILTSITGVGTTVVDGIQQTAKAENSVKLITNTNVAPYSGVTWMGAGTGFVVGNHTIITNKHVTYHMKVGDEIKAHPNGFYNNGGGLYKVTKIVDYPGKEDIAVVQVEEKSTQPKGRKFKDFTSKFNIASEAKENEPISVIGYPNPNGNKLQMYESTGKVLSVNGNIVTSDAVVQPGSSGSPILNSKREAIGVMYASDKPTGESTRSFAVYFSPEIKKFIADNLDK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]