Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS13575 [old locus tag: NWMN_2355 ]
- pan locus tag?: SAUPAN006014000
- symbol: NWMN_RS13575
- pan gene symbol?: —
- synonym:
- product: prevent-host-death protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS13575 [old locus tag: NWMN_2355 ]
- symbol: NWMN_RS13575
- product: prevent-host-death protein
- replicon: chromosome
- strand: -
- coordinates: 2592131..2592388
- length: 258
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGATTATCACTAGCCCTACAGAAGCGAGAAAAGATTTTTATCAATTACTAAAAAATGTT
AATAATAATCACGAACCAATTTATATTAGTGGCAATAATGCCGAAAATAATGCTGTGATT
ATAGGTTTAGAAGATTGGAAAAGTATACAAGAGACAATATATCTTGAATCTACTGGTACA
ATGGACAAAGTAAGAGAAAGAGAAAAAGATAATAGTGGTACAACAAATATAGATGATATT
GATTGGGATAATCTTTAA60
120
180
240
258
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS13575 [old locus tag: NWMN_2355 ]
- symbol: NWMN_RS13575
- description: prevent-host-death protein
- length: 85
- theoretical pI: 4.1354
- theoretical MW: 9774.67
- GRAVY: -0.805882
⊟Function[edit | edit source]
- TIGRFAM: Cellular processes Toxin production and resistance prevent-host-death family protein (TIGR01552; HMM-score: 37.9)Mobile and extrachromosomal element functions Other prevent-host-death family protein (TIGR01552; HMM-score: 37.9)and 1 moreProtein synthesis tRNA and rRNA base modification tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 11.4)
- TheSEED: see NWMN_2355
- PFAM: YefM-like (CL0871) PhdYeFM_antitox; Antitoxin Phd_YefM, type II toxin-antitoxin system (PF02604; HMM-score: 67.1)and 1 morePHD_like; Antitoxin of toxin-antitoxin, RelE / RelB, TA system (PF12910; HMM-score: 20.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.97
- Cytoplasmic Membrane Score: 0.0022
- Cell wall & surface Score: 0.0007
- Extracellular Score: 0.0271
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006313
- TAT(Tat/SPI): 0.000113
- LIPO(Sec/SPII): 0.000337
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIITSPTEARKDFYQLLKNVNNNHEPIYISGNNAENNAVIIGLEDWKSIQETIYLESTGTMDKVREREKDNSGTTNIDDIDWDNL
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]