Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS15105 [old locus tag: NWMN_0361 ]
- pan locus tag?: SAUPAN001960000
- symbol: NWMN_RS15105
- pan gene symbol?: —
- synonym:
- product: integrase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS15105 [old locus tag: NWMN_0361 ]
- symbol: NWMN_RS15105
- product: integrase
- replicon: chromosome
- strand: -
- coordinates: 410725..411036
- length: 312
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGCTTGGAATGATAAGTTTATTGATAGAGAGTACATATTCACAAATACGTCTGGTAGCC
CTATCGACTCGAACAAAATTAGCCACATTATTAAAGGGGGGCGCTGATATTAGTTCTATT
AAGAAACCTATAACGACGCATACATTACATCATTCGCATATATCTACACTTGCTCAATTA
GGAATTAACTTAAAAGCAATGCAAGAGCATGTAGGTCATTCAGATTATAAAAAAAATCTA
GAGATATACACACATGTTACTAATCAGATGGCGAAAGATATGATGAATAAATTTGAACGA
TTGGGGAGTTAA60
120
180
240
300
312
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS15105 [old locus tag: NWMN_0361 ]
- symbol: NWMN_RS15105
- description: integrase
- length: 103
- theoretical pI: 10.3
- theoretical MW: 11502.4
- GRAVY: -0.146602
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair integron integrase (TIGR02249; HMM-score: 50.7)Mobile and extrachromosomal element functions Other integron integrase (TIGR02249; HMM-score: 50.7)DNA metabolism DNA replication, recombination, and repair tyrosine recombinase XerD (TIGR02225; HMM-score: 48.1)and 1 moreDNA metabolism DNA replication, recombination, and repair tyrosine recombinase XerC (TIGR02224; HMM-score: 30.3)
- TheSEED: see NWMN_0361
- PFAM: DNA-mend (CL0382) Phage_integrase; Phage integrase family (PF00589; HMM-score: 32.8)and 1 moreno clan defined DUF3102; Protein of unknown function (DUF3102) (PF11300; HMM-score: 14.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.5813
- Cytoplasmic Membrane Score: 0.24
- Cell wall & surface Score: 0.004
- Extracellular Score: 0.1747
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.017319
- TAT(Tat/SPI): 0.002022
- LIPO(Sec/SPII): 0.005988
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLGMISLLIESTYSQIRLVALSTRTKLATLLKGGADISSIKKPITTHTLHHSHISTLAQLGINLKAMQEHVGHSDYKKNLEIYTHVTNQMAKDMMNKFERLGS
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]