Jump to navigation
Jump to search
04-0298108BA0217611819-97685071193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: S349 [1]
- symbol: S349
- synonym:
- product: RNA feature, 5'UTR of metN1*, S-box
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: misc_RNA
- locus tag: S349 [1]
- symbol: S349
- product: RNA feature, 5'UTR of metN1*, S-box
- replicon: chromosome
- strand: +
- coordinates: 812901..813069
- length: 169
- essential: unknown
⊟Accession numbers[edit | edit source]
- SRD: srn_2030 SRD
⊟Phenotype[edit | edit source]
- Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121ATTAATACAAATTAAATGATGCGTAAACTCTTATCGAGAGTGGTGGAGGGATGTGCCCTA
CGAAGCCCGGCAACCGTCTTATATAGAAATGGTGCCAATTCACATAAAGTTTTAACTTTT
GAAGATGAGAGAAACAATACTACTATTGCTTTCTCAATTTTTCTATCGA60
120
169
⊟Interactions
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2
Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]