Jump to navigation
Jump to search
COLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: S399 [1]
- symbol: S399
- synonym:
- product: RNA feature, 5'UTR of SAOUHSC_00957, yybP-ykoY motif
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: misc_RNA
- locus tag: S399 [1]
- symbol: S399
- product: RNA feature, 5'UTR of SAOUHSC_00957, yybP-ykoY motif
- replicon: chromosome
- strand: +
- coordinates: 931851..932071
- length: 221
- essential: unknown
⊟Accession numbers[edit | edit source]
- SRD: srn_2200 SRD
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181AAAAGGTATACTATGATGTATCAAATGAATAACCTATGGCATTTTGTCAGAGGGGAGTAA
CTTAAGAATCATGACCGTATAAATGATTCGACACTTTATCGTCATTACGAAGATATCTTC
CGGTAAAGTGGGCAATTTAAATTGCTTAGTGAGACCTTTGCTATTTATTTAGCATAGGTC
TTTTTGTTTGTACTTAACTTATTTATTTAAAGGAGTTGTAC60
120
180
221
⊟Interactions
- gene regulated by S399 / yybP-ykoY motif, 5' cis-acting region [2]transcription antitermination
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- predicted SigA promoter [1] : SAOUHSC_00954 > SAOUHSC_00955 > prfC > S398 > S399 > SAOUHSC_00957
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [1]
Multi-gene expression profiles
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2 1.3 1.4 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Michael Dambach, Melissa Sandoval, Taylor B Updegrove, Vivek Anantharaman, L Aravind, Lauren S Waters, Gisela Storz
The ubiquitous yybP-ykoY riboswitch is a manganese-responsive regulatory element.
Mol Cell: 2015, 57(6);1099-1109
[PubMed:25794618] [WorldCat.org] [DOI] (I p)