Jump to navigation
Jump to search
COLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: S696 [1]
- symbol: S696
- synonym:
- product: RNA feature, 3'UTR of SAOUHSC_01762
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: misc_RNA
- locus tag: S696 [1]
- symbol: S696
- product: RNA feature, 3'UTR of SAOUHSC_01762
- replicon: chromosome
- strand: -
- coordinates: 1662320..1662379
- length: 60
- essential: unknown
⊟Accession numbers[edit | edit source]
- SRD:
⊟Phenotype[edit | edit source]
- Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1TAGTAATCTGTTCATCAAGTAGTATCCGTGCTTGAAAACAAACTAAAACTCCTAATGTGG60
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [1]
Multi-gene expression profiles
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
