From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0517 [new locus tag: SA_RS03015 ]
  • pan locus tag?: SAUPAN002332000
  • symbol: SA0517
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0517 [new locus tag: SA_RS03015 ]
  • symbol: SA0517
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 603329..604198
  • length: 870
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGATAAAACTAATAGCCACTGATATGGATGGCACGCTACTTAATGCAGCACATGAAATT
    TCTCAACCTAATATTGATGCGATTAAATACGCTCAAGAACAAGGGATAACGGTTGTTATC
    GCGACAGGTCGAGCATTTTATGAAGCACAAGCACCAGTTGCTGACACAGATTTAACAGTA
    CCATATATTTGTTTGAATGGTGCTGAAGTACGTGATGAAACTTTCAATGTAATGAGCACT
    TCACACCTTAATAAATCGTTAGTACACAAAATTACAAATGTTTTAAAAGATGCAGGTATT
    TATTATCAAGTATACACGAGTCGTGCGATTTATACTGAAGATCCACAAAGAGATTTAGAC
    ATTTACATAGATATTGCTGAGCGTGCAGGTCAACATGCAAACGTTGAGCGTATTAAAAAT
    GGTATTCAAAGACGCATAGATAATGGTACGTTGAAAGTTGTTGATAATTATGATGCTATT
    GAAAACATACCTGGTGAATTAATTATGAAAATATTAGCATTTGATGGAAATTTAGAAAAA
    ATTGACAAAGCTAGTAAAATTTTAGCTGAATCTCCGAATTTAGCTATATCATCATCTTCG
    AGAGGAAATATAGAAATAACGCATTCAGATGCACAAAAAGGTATTGCGCTAGAAACAATT
    GCCGAAAGATTAGGGATTGAAATGAAAGATGTCATGGCAATAGGTGACAATTTAAATGAC
    TTATCAATGTTAGAGAAAGTTGGCTATCCAGTTGCGATGGAAAATGGTGCAGAAGAAGTT
    AAAAAAATAGCGAAATATGTCACAGATACGAATGAAAATAGTGGTGTTGGAAAAGCTATT
    ATGAAATTATTACGTGAACAACAAGTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    870

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0517 [new locus tag: SA_RS03015 ]
  • symbol: SA0517
  • description: hypothetical protein
  • length: 289
  • theoretical pI: 4.65124
  • theoretical MW: 31811
  • GRAVY: -0.216609

Function[edit | edit source]

  • TIGRFAM:
    Unknown function Enzymes of unknown specificity Cof-like hydrolase (TIGR00099; HMM-score: 210.8)
    and 17 more
    phosphoglycolate phosphatase, TA0175-type (TIGR01487; EC 3.1.3.18; HMM-score: 113.6)
    Unknown function Enzymes of unknown specificity HAD hydrolase, family IIB (TIGR01484; HMM-score: 92.3)
    sucrose-phosphate phosphatase subfamily (TIGR01482; EC 3.1.3.-; HMM-score: 84.6)
    mannosyl-3-phosphoglycerate phosphatase family (TIGR01486; EC 3.1.3.-; HMM-score: 59.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, YrbI family (TIGR01670; EC 3.1.3.45; HMM-score: 54.5)
    Unknown function General mannosyl-3-phosphoglycerate phosphatase homolog (TIGR02463; EC 3.1.3.-; HMM-score: 48.8)
    mannosyl-3-phosphoglycerate phosphatase (TIGR02461; EC 3.1.3.70; HMM-score: 45.1)
    Metabolism Energy metabolism Anaerobic phenylphosphate carboxylase, delta subunit (TIGR02726; HMM-score: 35.5)
    Unknown function Enzymes of unknown specificity HAD hydrolase, family IIIA (TIGR01662; HMM-score: 34.1)
    Metabolism Amino acid biosynthesis Serine family phosphoserine phosphatase SerB (TIGR00338; EC 3.1.3.3; HMM-score: 32.7)
    phosphoserine phosphatase-like hydrolase, archaeal (TIGR01491; HMM-score: 29.9)
    sucrose-phosphate synthase, sucrose phosphatase-like domain (TIGR02471; HMM-score: 24.5)
    Unknown function Enzymes of unknown specificity HAD hydrolase, family IB (TIGR01490; HMM-score: 24)
    sucrose phosphatase (TIGR01485; EC 3.1.3.24; HMM-score: 19.7)
    Unknown function Enzymes of unknown specificity HAD phosphoserine phosphatase-like hydrolase, family IB (TIGR01488; HMM-score: 19.6)
    Metabolism Energy metabolism Sugars phosphoglycolate phosphatase, bacterial (TIGR01449; EC 3.1.3.18; HMM-score: 17.4)
    histidinol-phosphate phosphatase domain (TIGR01656; HMM-score: 14.8)
  • TheSEED:  
    Hydrolase, HAD superfamily
  • PFAM:
    HAD (CL0137) Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 245.6)
    and 8 more
    S6PP; Sucrose-6F-phosphate phosphohydrolase (PF05116; HMM-score: 48.5)
    Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 34.6)
    HAD; haloacid dehalogenase-like hydrolase (PF12710; HMM-score: 17.6)
    HAD_2; haloacid dehalogenase-like hydrolase (PF13419; HMM-score: 15.7)
    Acid_phosphat_B; HAD superfamily, subfamily IIIB (Acid phosphatase) (PF03767; HMM-score: 13.8)
    no clan defined HrpF; HrpF protein (PF06266; HMM-score: 13.3)
    HTH (CL0123) RPA_C; Replication protein A C terminal (PF08784; HMM-score: 13.2)
    HAD (CL0137) Hydrolase_like; HAD-hyrolase-like (PF13242; HMM-score: 12.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007976
    • TAT(Tat/SPI): 0.000467
    • LIPO(Sec/SPII): 0.001077
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MIKLIATDMDGTLLNAAHEISQPNIDAIKYAQEQGITVVIATGRAFYEAQAPVADTDLTVPYICLNGAEVRDETFNVMSTSHLNKSLVHKITNVLKDAGIYYQVYTSRAIYTEDPQRDLDIYIDIAERAGQHANVERIKNGIQRRIDNGTLKVVDNYDAIENIPGELIMKILAFDGNLEKIDKASKILAESPNLAISSSSRGNIEITHSDAQKGIALETIAERLGIEMKDVMAIGDNLNDLSMLEKVGYPVAMENGAEEVKKIAKYVTDTNENSGVGKAIMKLLREQQV

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]