From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0527 [new locus tag: SA_RS03065 ]
  • pan locus tag?: SAUPAN002346000
  • symbol: nagB
  • pan gene symbol?: nagB
  • synonym:
  • product: glucosamine-6-phosphate isomerase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0527 [new locus tag: SA_RS03065 ]
  • symbol: nagB
  • product: glucosamine-6-phosphate isomerase
  • replicon: chromosome
  • strand: +
  • coordinates: 622117..622875
  • length: 759
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAAGTATTAAACTTAGGATCGAAAAAACAAGCATCATTCTATGTTGCATGTGAGTTA
    TATAAAGAGATGGCATTTAATCAGCACTGTAAACTAGGTTTAGCAACTGGTGGTACAATG
    ACAGATTTGTATGAACAACTTGTTAAGTTATTAAATAAAAATCAGTTAAACGTAGACAAT
    GTATCCACGTTTAATTTAGACGAATATGTAGGTTTAACCGCATCACATCCGCAAAGTTAT
    CACTATTATATGGATGACATGCTTTTCAAACAATATCCTTATTTTAATAGAAAGAACATT
    CATATTCCAAATGGAGATGCCGATGATATGAATGCGGAAGCGTCAAAATATAATGACGTT
    TTAGAACAACAAGGTCAACGTGATATTCAAATTTTAGGTATTGGTGAAAATGGTCATATT
    GGATTTAATGAACCTGGTACGCCGTTTGATAGCGTTACTCATATCGTTGATTTGACTGAA
    AGTACTATTAAGGCTAATAGTCGATATTTTAAAAACGAAGATGATGTTCCAAAGCAAGCC
    ATTTCGATGGGACTTGCTAATATTCTTCAAGCCAAACGTATCATTTTACTCGCATTTGGT
    GAAAAGAAACGTGCTGCTATTACACATTTATTAAATCAGGAAATTTCTGTTGATGTTCCA
    GCCACATTACTTCACAAACACCCGAATGTTGAGATATATTTAGACGACGAAGCTTGCCCG
    AAAAATGTTGCGAAAATTCATGTCGATGAAATGGATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    759

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0527 [new locus tag: SA_RS03065 ]
  • symbol: NagB
  • description: glucosamine-6-phosphate isomerase
  • length: 252
  • theoretical pI: 5.53277
  • theoretical MW: 28467.1
  • GRAVY: -0.41627

Function[edit | edit source]

  • reaction:
    EC 3.5.99.6?  ExPASy
    Glucosamine-6-phosphate deaminase Alpha-D-glucosamine 6-phosphate + H2O = D-fructose 6-phosphate + NH3
  • TIGRFAM:
    Metabolism Central intermediary metabolism Amino sugars glucosamine-6-phosphate deaminase (TIGR00502; EC 3.5.99.6; HMM-score: 245.9)
    and 2 more
    Metabolism Energy metabolism Pentose phosphate pathway 6-phosphogluconolactonase (TIGR01198; EC 3.1.1.31; HMM-score: 64.9)
    Metabolism Energy metabolism Pentose phosphate pathway ribose 5-phosphate isomerase A (TIGR00021; EC 5.3.1.6; HMM-score: 11.8)
  • TheSEED:  
    Carbohydrates Aminosugars Chitin and N-acetylglucosamine utilization  Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
    and 3 more
    One-carbon Metabolism Formaldehyde assimilation: Ribulose monophosphate pathway  Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
    Cell Wall and Capsule Capsular and extracellular polysacchrides Sialic Acid Metabolism  Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
    Cell Wall and Capsule - no subcategory UDP-N-acetylmuramate from Fructose-6-phosphate Biosynthesis  Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
  • PFAM:
    ISOCOT_Fold (CL0246) Glucosamine_iso; Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase (PF01182; HMM-score: 71.9)
    and 1 more
    Sugar-bind; Putative sugar-binding domain (PF04198; HMM-score: 17.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.019992
    • TAT(Tat/SPI): 0.000322
    • LIPO(Sec/SPII): 0.008769
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKVLNLGSKKQASFYVACELYKEMAFNQHCKLGLATGGTMTDLYEQLVKLLNKNQLNVDNVSTFNLDEYVGLTASHPQSYHYYMDDMLFKQYPYFNRKNIHIPNGDADDMNAEASKYNDVLEQQGQRDIQILGIGENGHIGFNEPGTPFDSVTHIVDLTESTIKANSRYFKNEDDVPKQAISMGLANILQAKRIILLAFGEKKRAAITHLLNQEISVDVPATLLHKHPNVEIYLDDEACPKNVAKIHVDEMD

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)