From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0675 [new locus tag: SA_RS03845 ]
  • pan locus tag?: SAUPAN002607000
  • symbol: SA0675
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0675 [new locus tag: SA_RS03845 ]
  • symbol: SA0675
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 768456..770333
  • length: 1878
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    ATGGAAGCATATAAAATTGAACATTTAAATAAATCTTATGCCGATAAGACTATATTCGAT
    AACCTAGATTTATCAATTTCAGAAGGTGAAAAAATAGGTTTGGTGGGCATAAATGGTACA
    GGGAAAAGTACGTTGTTAAAAGTAATTGGTGGTATTGATGATGATTTTACAGCCAATGTT
    ATGCATCCAAATCAATATCGAATTCGATATTCGTCTCAGAAACAGGACCTTAATGAAGAT
    ATGACAGTTTTTGATGCAGTATTAAGTTCTGATACAACAACTTTACGCATCATCAAGCAA
    TATGAGCAGGCAGTACAAGCTTATGCGGATGACCAAAGTGATAAATTGTTCAAGCGAATG
    ATAGATGCGCAAGATGCTATGGATCAACATGATGCTTGGGACTATAACGCTGAAATTAAA
    ACAATCCTCTCAAAACTAGGTATACATGATACTACTAAATACATTAAAGAATTATCCGGC
    GGACAACAAAAACGTGTTGTACTTGCTAAAACATTAATAGAACAACCAGATTTATTGTTA
    TTAGATGAACCTACGAACCATTTAGACTTCGAATCAATCAGCTGGTTGATCAATTATGTG
    AAGCAATATCCTCATACAGTTTTATTCGTAACCCATGATCGATATTTTTTAAATGAAGTT
    TCCACTAGAATTATTGAACTAAACAGAGGTAAGTTAGCGTCATATCCTGGTAACTATGAA
    TCTTATATTGAAATGCGCGCTGAAAGAGAAGTAACACTTCAAAAGCAACAACAAAAGCAA
    CGAGCTTTATATAAGGAAGAACTTGCTTGGATGAGGGCTGGAGCTAAGGCTCGTACTACA
    AAGCAACAAGCTAGAATTAATCGATTTAATGACCTAGAAAATGAAGTTAACCAGCAATAT
    AAAGACGATAAAGGTGAATTGAATCTTGCTTATTCAAGATTAGGTAAGCAAGTGTTCGAA
    TTAGAAGACTTATCAAAGGCTATTAATGATAAAGTATTATTTGAACATCTGACGGAAATT
    ATTCAAAAAGGTGAGCGTATTGGTGTTGTTGGGCCAAATGGAGCTGGTAAAACAACACTC
    TTAAATATTTTGAGTGGAGAAGACCAACAATTCGAAGGTAAATTGAAGACTGGGCAGACG
    GTTAAAGTAGCTTATTTTAAGCAAACAGATGAGACCCTGGATAGAGATATTCGTATGATT
    GATTATTTAAGAGAAGAAAGTGAGGTCGCAAAAGAAAAAGATGGAACCTCGGTATCTATT
    ACACAACTTCTTGAACGATTTTTATTTCCAAGTGCAACTCATGGTAAAAAAGTTTATAAA
    TTATCTGGTGGAGAGCAAAAGCGTTTGTATTTATTACGTCTACTCGTACACCAGCCAAAT
    GTTCTGTTGTTAGATGAACCGACAAATGATTTAGATACTGAGACTTTAACAATACTTGAA
    GATTATATTCATACTTTCGGTGGTACAGTGATTACCGTAAGCCATGATCGCTACTTCTTA
    AATAAAGTTGCACAGTCATATTGGTTTATTCATGATGGTCAGATGGAAAAGATTATCGGA
    ACTTTTGAAGATTATGAAAGTTATAAAAAATCATTAGATAAAAATAAATCCACATTGAAG
    CAACAATCTAAATCTTATACAACTGTACGTAAGAAAAATGGTTTATCATATAAAGAAAAA
    TTAGAATATGAACAATTGATGAAACGCATAGAACAAGCGGAAGTAAGAATGGAAGAAATT
    GATGTGCTCATGATTGAGGCAAGTGCAGATTATGGGAAAATTAAAGAACTAAACGAAGAA
    AAAGAACAACTTGAAATTCAATATGATTTAGACATCACAAGATGGAGTGAGTTAGAAGAA
    ATTAAAGAACAACAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1878

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0675 [new locus tag: SA_RS03845 ]
  • symbol: SA0675
  • description: hypothetical protein
  • length: 625
  • theoretical pI: 5.1352
  • theoretical MW: 72453.3
  • GRAVY: -0.65744

Function[edit | edit source]

  • TIGRFAM:
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 493.4)
    and 91 more
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 185.3)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 185.3)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 158.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 157.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 157.4)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 156.8)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 155.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 152.8)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 152.1)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 150.7)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 150.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 150.2)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 146.8)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 146.7)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 146.1)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 145.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 140.9)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 140.9)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 140.1)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 135.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 130.5)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 129.4)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 129.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 128.8)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 127.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 124.9)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 124.9)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 124.2)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 121.7)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 121.3)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 121.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 117.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 117.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 117.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 117.2)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 117.2)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 116.1)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 116.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 113.8)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 112.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 112)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 108.4)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 106)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 106)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 105.8)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 104.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 103.5)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 97.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 94.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 94.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 94.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 94.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 93.2)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 89.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 89)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 86.8)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 82.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 78.2)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 78.2)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 76.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 62.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 61.9)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 61.9)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 59)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 55.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 53.7)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 38.4)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 25.1)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 21)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 21)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 20.8)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 20.8)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 17.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 17.2)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 17.2)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 16.8)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 16.4)
    Metabolism Central intermediary metabolism Nitrogen metabolism urease accessory protein UreG (TIGR00101; HMM-score: 15.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 15.4)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 15.3)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 15.2)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 15.1)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 13.8)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 13.2)
    Cellular processes Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 11.7)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 11)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 9.7)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 9.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 3.9)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  COG0488: ATPase components of ABC transporters with duplicated ATPase domains
    and 1 more
    Test - Folate  COG0488: ATPase components of ABC transporters with duplicated ATPase domains
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 170.5)
    and 35 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 67.8)
    ABC_tran_Xtn; ABC transporter (PF12848; HMM-score: 43.3)
    no clan defined ABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 43.3)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 41)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 31)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 29.1)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.7)
    AAA_18; AAA domain (PF13238; HMM-score: 28)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 25.4)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 23.5)
    AAA_30; AAA domain (PF13604; HMM-score: 22.7)
    AAA_22; AAA domain (PF13401; HMM-score: 22.5)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 21.9)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 19.9)
    ArgK; ArgK protein (PF03308; HMM-score: 19.8)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 18.8)
    no clan defined Bacillus_HBL; Bacillus haemolytic enterotoxin (HBL) (PF05791; HMM-score: 18.6)
    P-loop_NTPase (CL0023) Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 18.5)
    AAA_28; AAA domain (PF13521; HMM-score: 18.3)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 18)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 17.6)
    AAA_33; AAA domain (PF13671; HMM-score: 16.7)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 16)
    AAA_25; AAA domain (PF13481; HMM-score: 15.2)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 14.5)
    AAA_24; AAA domain (PF13479; HMM-score: 14.5)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 13.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.4)
    NACHT; NACHT domain (PF05729; HMM-score: 13.2)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.8)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 11.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 10)
    AAA_27; AAA domain (PF13514; HMM-score: 9.3)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 7.7)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 6.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.020043
    • TAT(Tat/SPI): 0.000334
    • LIPO(Sec/SPII): 0.000632
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MEAYKIEHLNKSYADKTIFDNLDLSISEGEKIGLVGINGTGKSTLLKVIGGIDDDFTANVMHPNQYRIRYSSQKQDLNEDMTVFDAVLSSDTTTLRIIKQYEQAVQAYADDQSDKLFKRMIDAQDAMDQHDAWDYNAEIKTILSKLGIHDTTKYIKELSGGQQKRVVLAKTLIEQPDLLLLDEPTNHLDFESISWLINYVKQYPHTVLFVTHDRYFLNEVSTRIIELNRGKLASYPGNYESYIEMRAEREVTLQKQQQKQRALYKEELAWMRAGAKARTTKQQARINRFNDLENEVNQQYKDDKGELNLAYSRLGKQVFELEDLSKAINDKVLFEHLTEIIQKGERIGVVGPNGAGKTTLLNILSGEDQQFEGKLKTGQTVKVAYFKQTDETLDRDIRMIDYLREESEVAKEKDGTSVSITQLLERFLFPSATHGKKVYKLSGGEQKRLYLLRLLVHQPNVLLLDEPTNDLDTETLTILEDYIHTFGGTVITVSHDRYFLNKVAQSYWFIHDGQMEKIIGTFEDYESYKKSLDKNKSTLKQQSKSYTTVRKKNGLSYKEKLEYEQLMKRIEQAEVRMEEIDVLMIEASADYGKIKELNEEKEQLEIQYDLDITRWSELEEIKEQQ

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]