From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0714 [new locus tag: SA_RS04065 ]
  • pan locus tag?: SAUPAN002676000
  • symbol: uvrA
  • pan gene symbol?: uvrA
  • synonym:
  • product: excinuclease ABC subunit A

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0714 [new locus tag: SA_RS04065 ]
  • symbol: uvrA
  • product: excinuclease ABC subunit A
  • replicon: chromosome
  • strand: +
  • coordinates: 814934..817780
  • length: 2847
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    ATGAAAGAACCATCCATAGTAGTAAAAGGTGCTCGTGCGCATAACTTGAAAGATATTGAT
    ATCGAACTACCTAAAAATAAATTAATTGTTATGACAGGTTTATCTGGGTCAGGTAAATCG
    TCATTAGCATTCGATACTATATATGCTGAAGGACAACGACGTTATGTTGAATCATTAAGT
    GCCTATGCGCGTCAATTTTTAGGCCAAATGGACAAACCAGATGTTGATACAATTGAAGGA
    TTATCGCCAGCAATTTCAATAGATCAAAAAACAACAAGTAAAAATCCAAGATCAACTGTA
    GCAACAGTAACAGAAATATATGATTATATACGTTTGTTATATGCACGTGTTGGTAAACCT
    TACTGTCCAAATCACAATATAGAAATTGAATCGCAAACAGTACAACAAATGGTTGACCGC
    ATTATGGAATTAGAGGCACGTACAAAGATTCAATTATTAGCACCTGTCATCGCTCATCGT
    AAAGGTAGTCATGAAAAGCTAATCGAAGATATTGGTAAAAAAGGTTATGTACGTTTAAGA
    ATCGATGGCGAAATTGTTGATGTAAATGATGTACCTACTTTAGATAAGAACAAGAATCAT
    ACAATAGAAGTTGTTGTAGACCGATTAGTTGTTAAAGATGGAATTGAAACACGACTAGCT
    GACTCTATAGAAACTGCGTTAGAGCTTTCAGAAGGACAATTAACAGTTGATGTCATTGAC
    GGGGAAGACCTTAAGTTTTCAGAAAGCCATGCTTGTCCTATATGTGGATTTTCAATCGGA
    GAGTTAGAACCAAGAATGTTTAGCTTTAACAGTCCTTTTGGTGCTTGTCCGACATGTGAT
    GGCTTAGGCCAAAAGTTAACAGTCGATGTAGACTTGGTTGTTCCCGACAAAGATAAGACG
    CTAAACGAAGGTGCAATAGAACCTTGGATACCGACGAGTTCTGATTTTTATCCAACATTG
    TTAAAACGTGTTTGTGAAGTTTATAAAATCAATATGGATAAACCTTTTAAAAAGTTAACA
    GAACGTCAACGTGATATTTTATTGTATGGTTCTGGTGACAAAGAAATTGAATTTACATTT
    ACACAACGTCAAGGTGGTACTAGAAAACGAACAATGGTTTTCGAGGGTGTAGTTCCTAAT
    ATAAGTAGACGATTCCATGAATCTCCTTCAGAATATACACGTGAAATGATGAGTAAATAT
    ATGACCGAACTACCTTGTGAAACTTGTCATGGAAAGCGATTGAGTCGTGAAGCGTTATCT
    GTTTATGTAGGTGGTTTAAATATTGGTGAAGTAGTCGAATATTCAATCAGTCAAGCGCTG
    AACTATTATAAAAACATTGATTTGTCAGAACAAGATCAAGCGATTGCAAATCAAATATTG
    AAAGAAATTATTTCCCGACTCACTTTTTTAAATAATGTGGGACTTGAATATTTAACGCTA
    AACAGAGCTTCAGGTACACTTTCAGGTGGTGAAGCACAACGTATTCGATTGGCAACGCAA
    ATTGGGTCGCGTTTGACTGGTGTCTTATATGTATTAGATGAGCCATCAATTGGACTGCAT
    CAAAGAGATAATGATCGATTAATTAATACACTTAAAGAAATGAGAGATTTAGGAAATACT
    TTAATTGTAGTTGAACACGATGATGATACAATGCGTGCGGCTGATTACTTAGTGGATATA
    GGGCCTGGTGCTGGTGAACATGGAGGACAAATTGTGTCTAGTGGGACACCTCAAAAGGTA
    ATGAAAGATAAAAAATCATTAACAGGACAATACTTGAGTGGTAAGAAACGTATTGACGTA
    CCTGAATATCGCAGACCGGCTTCAGATCGTAAAATTTCTATACGTGGAGCTAGAAGCAAC
    AATCTTAAAGGGATTGATGTGGACATACCACTATCAATCATGACGGTTGTTACAGGTGTA
    TCAGGTTCTGGTAAAAGCTCATTAGTAAATGAAGTATTATACAAATCATTAGCTCAAAAA
    ATTAATAAATCTAAAGTAAAGCCAGGATTGTACGATAAGATTGAAGGTATTGATCAACTT
    GATAAAATTATTGATATTGATCAATCACCGATAGGTAGAACGCCACGCTCTAATCCAGCA
    ACATATACTGGTGTGTTTGATGATATACGTGATGTGTTTGCGCAAACAAATGAAGCTAAA
    ATTCGAGGATATCAAAAAGGGCGTTTTAGTTTTAATGTAAAAGGTGGACGCTGTGAAGCT
    TGTAAAGGTGACGGTATTATTAAAATTGAAATGCATTTTTTACCTGATGTTTATGTTCCT
    TGTGAAGTGTGTGATGGTAAACGATATAATCGTGAGACACTAGAGGTTACTTACAAAGGT
    AAAAATATTGCTGACATTTTAGAAATGACTGTTGAAGAAGCAACACAATTTTTTGAAAAT
    ATTCCTAAGATTAAGCGCAAGTTACAAACACTAGTTGATGTTGGTCTTGGATACGTCACA
    TTAGGTCAACAAGCTACAACGTTATCAGGTGGTGAGGCTCAACGTGTGAAACTTGCATCT
    GAACTTCATAAACGTTCAACTGGTAAATCTATTTATATCCTAGACGAACTAACAACAGGG
    TTACATGTTGACGATATTAGCAGATTATTAAAAGTATTAAATCGATTAGTTGAAAATGGT
    GACACTGTTGTAATTATTGAACATAACCTAGATGTTATCAAAACAGCAGACTATATTATC
    GACTTAGGTCCTGAAGGTGGTAGTGGCGGTGGTACTATTGTTGCGACTGGCACACCCGAA
    GATATTGCTCAGACAAAGTCATCATATACAGGAAAGTATTTAAAAGAAGTACTTGAACGA
    GATAAACAAAATACTGAAGATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2847

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0714 [new locus tag: SA_RS04065 ]
  • symbol: UvrA
  • description: excinuclease ABC subunit A
  • length: 948
  • theoretical pI: 6.28065
  • theoretical MW: 105383
  • GRAVY: -0.380274

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 1489.7)
    and 74 more
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 110.1)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 109.2)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 103)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 103)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 100.3)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 95.1)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 89.2)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 85.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 83.1)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 75.8)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 73.1)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 70.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 69.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 67.1)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 67.1)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 66.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 66.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 65.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 63.3)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 63)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 61.6)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 60.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 58.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 58.3)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 58.3)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 58.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 57.5)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 55.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 55.3)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 54.6)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 54.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 54.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 54.2)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 53.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 53)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 53)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 51.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 51.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 51.2)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 47.8)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 47.7)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 46.7)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 46.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 45)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 45)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 44.2)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 44.2)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 40.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 40.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 39.4)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 38.5)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 38)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 38)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 35.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 34.7)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 34.4)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 34.1)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 33.6)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 31.1)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 31.1)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 29.4)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 26.2)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 22.8)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 22.8)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 18.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 18.5)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 18.5)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 17.5)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 17.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 17)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 15.7)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 14.1)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 10.7)
    Genetic information processing Transcription RNA processing polynucleotide kinase-phosphatase (TIGR04075; HMM-score: 10.5)
  • TheSEED:  
    DNA Metabolism DNA repair DNA repair, UvrABC system  Excinuclease ABC subunit A
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 63.4)
    and 25 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 50.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 29.9)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 27.8)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 27.5)
    no clan defined DnaJ_CXXCXGXG; DnaJ central domain (PF00684; HMM-score: 23.5)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 22.5)
    AAA_33; AAA domain (PF13671; HMM-score: 22)
    AAA_22; AAA domain (PF13401; HMM-score: 21.7)
    AAA_14; AAA domain (PF13173; HMM-score: 20.2)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 19.9)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 19.7)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 19.3)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 17.4)
    AAA_18; AAA domain (PF13238; HMM-score: 17.4)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 16.5)
    Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 15.6)
    DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 15.3)
    AAA_24; AAA domain (PF13479; HMM-score: 15.1)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.3)
    NACHT; NACHT domain (PF05729; HMM-score: 13.8)
    ATPase; KaiC (PF06745; HMM-score: 13.8)
    AAA_25; AAA domain (PF13481; HMM-score: 13.2)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.1)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 11.1)
    no clan defined Anti-TRAP; Tryptophan RNA-binding attenuator protein inhibitory protein (PF15777; HMM-score: 10.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.017213
    • TAT(Tat/SPI): 0.005707
    • LIPO(Sec/SPII): 0.003096
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKEPSIVVKGARAHNLKDIDIELPKNKLIVMTGLSGSGKSSLAFDTIYAEGQRRYVESLSAYARQFLGQMDKPDVDTIEGLSPAISIDQKTTSKNPRSTVATVTEIYDYIRLLYARVGKPYCPNHNIEIESQTVQQMVDRIMELEARTKIQLLAPVIAHRKGSHEKLIEDIGKKGYVRLRIDGEIVDVNDVPTLDKNKNHTIEVVVDRLVVKDGIETRLADSIETALELSEGQLTVDVIDGEDLKFSESHACPICGFSIGELEPRMFSFNSPFGACPTCDGLGQKLTVDVDLVVPDKDKTLNEGAIEPWIPTSSDFYPTLLKRVCEVYKINMDKPFKKLTERQRDILLYGSGDKEIEFTFTQRQGGTRKRTMVFEGVVPNISRRFHESPSEYTREMMSKYMTELPCETCHGKRLSREALSVYVGGLNIGEVVEYSISQALNYYKNIDLSEQDQAIANQILKEIISRLTFLNNVGLEYLTLNRASGTLSGGEAQRIRLATQIGSRLTGVLYVLDEPSIGLHQRDNDRLINTLKEMRDLGNTLIVVEHDDDTMRAADYLVDIGPGAGEHGGQIVSSGTPQKVMKDKKSLTGQYLSGKKRIDVPEYRRPASDRKISIRGARSNNLKGIDVDIPLSIMTVVTGVSGSGKSSLVNEVLYKSLAQKINKSKVKPGLYDKIEGIDQLDKIIDIDQSPIGRTPRSNPATYTGVFDDIRDVFAQTNEAKIRGYQKGRFSFNVKGGRCEACKGDGIIKIEMHFLPDVYVPCEVCDGKRYNRETLEVTYKGKNIADILEMTVEEATQFFENIPKIKRKLQTLVDVGLGYVTLGQQATTLSGGEAQRVKLASELHKRSTGKSIYILDELTTGLHVDDISRLLKVLNRLVENGDTVVIIEHNLDVIKTADYIIDLGPEGGSGGGTIVATGTPEDIAQTKSSYTGKYLKEVLERDKQNTEDK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: LexA (repression) regulon
    LexA(TF)important in SOS response; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]