Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0928 [new locus tag: SA_RS05255 ]
- pan locus tag?: SAUPAN003291000
- symbol: SA0928
- pan gene symbol?: thiW
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0928 [new locus tag: SA_RS05255 ]
- symbol: SA0928
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 1053905..1055305
- length: 1401
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123751 NCBI
- RefSeq: NP_374195 NCBI
- BioCyc: see SA_RS05255
- MicrobesOnline: 103221 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381GTGTTAAAAGTAAGTGATTTACGATTAAAATATCCAAATGGTCAGCGTAAAATTTTCGAT
CATTTAAATATCACTATTCAAGACAAAGAAAAAGTACTTTTACTCGGTCCTTCTGGTTGC
GGTAAAAGTACACTTCTGAATGTATTAAGTGGTATTGTTCCTAATTTAATTGAATTACCT
ATGAAATATGATGAACTAATCGTTGACCCATTAAGTGGCGTTATTTTCCAAGACCCTGAT
AGCCAGTTTTGTATGCCAAAAGTATACGAAGAACTTGCATTCGTTTTAGAAAATAGACAA
GTACCACGTGAAGACATGGATGCGTTAATTATCAATGCTTTAAATATGGTCAATTTAAAT
GTTACCCCTGAAACGTATATCAAAGATTTAAGTGGCGGGATGAAACAGAAATTGGCAATT
GTTGAAACCATTCTTCAACAATCAAAAACATTGTTTTTAGATGAACCGACAGCAATGTTA
GATGTTCAAGCAACAGAAGATTTATGGACTAAACTAATTGAACTTTGGGAAGATCAAACT
GTTGTAATCGTTGAACATAAAGTTAAACACATCTGGAATCATGTCGACCGCGTCATTTTG
ATGGATTATAACGGAAATATCATTGCCGATGAATGTCCTGAAATCATATTACAGAAGTAT
GTTCATTTACTCAGTGAATATGGTGTGTGGCATCCACGTGCATGGGAATTCGCACCAAGT
CGTGTTGACTTTCCAACAACAAACTCACACTTATTACAATTTAAAAATGGACGTATTATT
CGCGGTAAATCAACATTGCTCTCATTCTCAGATTTAGAAATTGGTCTAGGTGAGTGGATT
ACAATTACAGGGGCAAATGGTAGTGGTAAAACAACCTTGCTTGAATCAATTATGCAATTG
ATTAAATATCAAGGTGATGTTTATTTTGAAAATCAGCGTTTAACAAAAATTAAACATGCA
GCAAAACACATGTACCTAGTTTATCAAAACCCAGAATTACAATTTATAACAAATTCGGTT
TATGATGAAATTAACATTCATTTTAATCACCTTTCTAAAGATCAAAGTGATGATGAAACG
ATACAACTTTTAAAACTTTTAGATTTACAAAATGTAAAAGATCAACATCCTTATGAGTTG
TCTATTGGTCAAAAACGACGCCTTAGCGTAGCTACCGCACTAAGTTCTAAAGCTGATATT
ATCTTTTTAGATGAACCGACATTTGGACTTGATAGCCATAATACATTCCAGTTGATCAAA
CTTTTCCAAAAGCGAATTAATTTGGGACAAAGTATTGTCATGGTTACACATGACGATGAA
ATAATTGAACGTTATCCATCAAGAAGACTTAAAATTTCAGATGGTGCGTTACTAGATTGT
GATGGTGATACGAATGTATGA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1401
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0928 [new locus tag: SA_RS05255 ]
- symbol: SA0928
- description: hypothetical protein
- length: 466
- theoretical pI: 5.21638
- theoretical MW: 53329
- GRAVY: -0.18691
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 246.9)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 230)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 203.5)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 203.5)and 101 moreTransport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 191.4)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 179.8)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 176.7)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 171.1)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 170)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 166.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 166.2)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 162.5)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 162.5)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 162.1)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 161.7)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 161.4)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 159.3)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 153.8)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 153.2)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 152.9)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 152.9)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 152.1)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 150.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 143.4)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 141.4)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 137.7)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 137.2)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 133.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 132.7)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 132.7)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 132.3)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 130.2)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 127.3)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 126.6)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 125.2)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 123.6)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 120.3)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 118.5)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 116.5)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 112.5)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.3)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.3)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 109.1)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 104)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 104)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 103.6)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 103.6)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 99.8)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 98.8)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 98.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 98.7)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 96.6)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 93.6)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 92.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 92.8)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 90.2)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 86.8)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 85.4)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 78)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 76)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 75.2)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 66.8)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 62.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 54.8)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 53.8)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 53)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 53)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 30.2)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 24)helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 23.3)Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 22.8)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 21.9)DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 20.2)DNA metabolism Restriction/modification DNA sulfur modification protein DndD (TIGR03185; HMM-score: 20)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 19.8)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 19.3)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 18.3)rad50 (TIGR00606; HMM-score: 18.3)DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 18)DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 18)Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 17.5)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 16.7)Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 16.7)Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 15.9)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 15.9)Cell envelope Surface structures twitching motility protein (TIGR01420; HMM-score: 15.3)Cellular processes Chemotaxis and motility twitching motility protein (TIGR01420; HMM-score: 15.3)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 14.9)Dot/Icm secretion system ATPase DotB (TIGR02524; HMM-score: 14.6)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.4)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.4)Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 13.9)Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 13.5)Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.2)Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.2)Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 13)Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 12.9)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 12.3)Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 12)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12)Cellular processes Pathogenesis type VI secretion protein IcmF (TIGR03348; HMM-score: 9.3)
- TheSEED :
- Thiamin-regulated hydroxymethylpyrimidine ECF transporter, duplicated ATPase component of energizing module YkoD
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 168.1)and 70 moreAAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 73)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 43.6)AAA_23; AAA domain (PF13476; HMM-score: 42.1)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 40.1)AAA_16; AAA ATPase domain (PF13191; HMM-score: 35.5)AAA_18; AAA domain (PF13238; HMM-score: 32)AAA_15; AAA ATPase domain (PF13175; HMM-score: 31.9)AAA_22; AAA domain (PF13401; HMM-score: 31.4)NACHT; NACHT domain (PF05729; HMM-score: 30.5)AAA_28; AAA domain (PF13521; HMM-score: 29.7)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 28.2)AAA_14; AAA domain (PF13173; HMM-score: 28.1)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 28)NB-ARC; NB-ARC domain (PF00931; HMM-score: 27.6)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 27.4)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 26.6)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 26)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 26)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 25.9)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 25.5)RNA_helicase; RNA helicase (PF00910; HMM-score: 24.6)AAA_19; AAA domain (PF13245; HMM-score: 23.7)NTPase_1; NTPase (PF03266; HMM-score: 22.6)AAA_24; AAA domain (PF13479; HMM-score: 22.3)AAA_30; AAA domain (PF13604; HMM-score: 22.2)MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 22)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 21.9)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 20.7)ABC_ATPase; P-loop domain (PF09818; HMM-score: 20.7)PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 20.5)AAA_25; AAA domain (PF13481; HMM-score: 20.1)AAA_33; AAA domain (PF13671; HMM-score: 20)cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 19.5)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 19.3)AAA_17; AAA domain (PF13207; HMM-score: 18.6)NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 18.6)KAP_NTPase; KAP family P-loop domain (PF07693; HMM-score: 18.2)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 17.9)Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 17.9)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.8)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 17.7)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 17.7)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 17.4)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 17.4)PIF1; PIF1-like helicase (PF05970; HMM-score: 17)bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 16.9)ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 16.5)AAA_13; AAA domain (PF13166; HMM-score: 16.5)DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 16.5)ORC-CDC6-like; ORC-CDC6-like (PF24389; HMM-score: 16.4)dNK; Deoxynucleoside kinase (PF01712; HMM-score: 16.1)GvpD_P-loop; GvpD gas vesicle protein, P-loop domain (PF07088; HMM-score: 15.8)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 15.5)Septin; Septin (PF00735; HMM-score: 15.4)RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 15.3)SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 15.3)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 15.1)DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 15)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 14.2)TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 13.8)ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 13.6)Thymidylate_kin; Thymidylate kinase (PF02223; HMM-score: 13.4)VapE-like_dom; Virulence-associated protein E-like domain (PF05272; HMM-score: 13.4)AAA_27; AAA domain (PF13514; HMM-score: 13.3)SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 13.2)FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 13)Dynamin_N; Dynamin family (PF00350; HMM-score: 12.4)MCM; MCM P-loop domain (PF00493; HMM-score: 11.8)IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 11.8)Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 11)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.3245
- Cytoplasmic Membrane Score: 0.6701
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0053
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004759
- TAT(Tat/SPI): 0.000319
- LIPO(Sec/SPII): 0.012004
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLKVSDLRLKYPNGQRKIFDHLNITIQDKEKVLLLGPSGCGKSTLLNVLSGIVPNLIELPMKYDELIVDPLSGVIFQDPDSQFCMPKVYEELAFVLENRQVPREDMDALIINALNMVNLNVTPETYIKDLSGGMKQKLAIVETILQQSKTLFLDEPTAMLDVQATEDLWTKLIELWEDQTVVIVEHKVKHIWNHVDRVILMDYNGNIIADECPEIILQKYVHLLSEYGVWHPRAWEFAPSRVDFPTTNSHLLQFKNGRIIRGKSTLLSFSDLEIGLGEWITITGANGSGKTTLLESIMQLIKYQGDVYFENQRLTKIKHAAKHMYLVYQNPELQFITNSVYDEINIHFNHLSKDQSDDETIQLLKLLDLQNVKDQHPYELSIGQKRRLSVATALSSKADIIFLDEPTFGLDSHNTFQLIKLFQKRINLGQSIVMVTHDDEIIERYPSRRLKISDGALLDCDGDTNV
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SA0927 < SA0928 < SA0929
⊟Regulation[edit | edit source]
- regulator: THI-box (transcription termination) regulon
THI-box (RNA) important in Thiamine biosynthesis; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]