From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1698 [new locus tag: SA_RS09745 ]
  • pan locus tag?: SAUPAN004897000
  • symbol: SA1698
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1698 [new locus tag: SA_RS09745 ]
  • symbol: SA1698
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1944859..1945134
  • length: 276
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    ATGGAAAATAAATTTGTTCCTGGTATTTTAATTGGTGCCGTAATTGGTGGTGCAATTAGT
    TTAGCTGATAAATCTACACGTCAAGCTTTAGTTCAATCAGTTAAAGATGCAAAAAATGGT
    AACCGCACTCGTAAGCCTTCTAAAGTCAGCAAGATTAAAGACGAAGTTTTATACTGGAAA
    GATGTTGTTGAAGAAATTCGTCGTAATAATCCTGAATTAGAACGTTCATTAAAGGATGCG
    AAAGAAACATTTGTTAATAGAAAAAATCAACGCTAA
    60
    120
    180
    240
    276


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1698 [new locus tag: SA_RS09745 ]
  • symbol: SA1698
  • description: hypothetical protein
  • length: 91
  • theoretical pI: 10.8021
  • theoretical MW: 10321.8
  • GRAVY: -0.767033

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED  :
    • Hypothetical protein YfkI
    CBSS-176280.1.peg.1561  FIG010063: hypothetical protein
  • PFAM:
    no clan defined LSU; Response to Low Sulfur (LSU) family (PF24980; HMM-score: 14.1)
    and 1 more
    YtxH; YtxH-like protein (PF12732; HMM-score: 9.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.0299
    • Cytoplasmic Membrane Score: 0.8529
    • Cell wall & surface Score: 0.07
    • Extracellular Score: 0.0472
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: 0
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: Signal peptide SP(Sec/SPI) length 29 aa
    • SP(Sec/SPI): 0.490585
    • TAT(Tat/SPI): 0.043363
    • LIPO(Sec/SPII): 0.076147
    • Cleavage Site: CS pos: 29-30. RQA-LV. Pr: 0.0985
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MENKFVPGILIGAVIGGAISLADKSTRQALVQSVKDAKNGNRTRKPSKVSKIKDEVLYWKDVVEEIRRNNPELERSLKDAKETFVNRKNQR

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]