From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1946 [new locus tag: SA_RS11175 ]
  • pan locus tag?: SAUPAN005442000
  • symbol: SA1946
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1946 [new locus tag: SA_RS11175 ]
  • symbol: SA1946
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2195926..2196591
  • length: 666
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATATTTTGGTTATAGGTGCTAATGGCGGTGTAGGTTCGTTACTAGTGCAACAATTA
    GCAAAAGAAAATGTACCATTTACTGCTGGTGTTAGGCAATCAGATCAACTTAATGCGTTA
    AAATCACAAGGTATGAAAGCAATTCTTGTTGATGTTGAAAATGATTCAATAGAGACTTTA
    ACTGAGACGTTTAAACCATTCGATAAAGTTATCTTTTCAGTAGGTTCTGGAGGGAACACG
    GGTGCAGATAAAACAATTATTGTCGATTTAGATGGTGCTGTTAAATCAATGATTGCGAGT
    AAAGAGGCTAATATTAAACACTATGTCATGGTTTCAACATATGATTCGAGACGTCAGGCT
    TTTGATGATAGCGGTGATTTAAAGCCATATACAATAGCTAAACATTACGCTGATGACTAT
    TTAAGACGTTCAGGTTTGAATTATACAATTTTACATCCAGGGGCACTTACAAATGCAGCA
    GGATCTGGAAAGATAGAAGCTGCACAATATTTTGATGGTAAAGGTGAAATTCCTAGAGAA
    GATGTTGCGACAGTATTAAAAGAAATTGTCACATCCAATCATTTTAATCACCAAGAGTTT
    CAAATTATTAGTGGTGAGCAGGACATTAAAGATGCTTTAACTCAATTTGAAATTGAAAAG
    GATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    666

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1946 [new locus tag: SA_RS11175 ]
  • symbol: SA1946
  • description: hypothetical protein
  • length: 221
  • theoretical pI: 4.81598
  • theoretical MW: 24071.9
  • GRAVY: -0.274661

Function[edit | edit source]

  • TIGRFAM:
    Unknown function Enzymes of unknown specificity putative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 21.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A 2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 18.9)
    and 9 more
    thioester reductase domain (TIGR01746; HMM-score: 16.2)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides ADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 14.8)
    Metabolism Amino acid biosynthesis Aspartate family aspartate-semialdehyde dehydrogenase (TIGR01296; EC 1.2.1.11; HMM-score: 14.6)
    Metabolism Energy metabolism Fermentation zinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 13.1)
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 12.6)
    ergot alkaloid biosynthesis protein, AFUA_2G17970 family (TIGR03649; HMM-score: 12.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, substrate binding protein, PQQ-dependent alcohol dehydrogenase system (TIGR03863; HMM-score: 12.3)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides dTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 11.9)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 10.7)
  • TheSEED:  
    NAD-dependent epimerase/dehydratase
  • PFAM:
    NADP_Rossmann (CL0063) NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 138.7)
    and 10 more
    NmrA; NmrA-like family (PF05368; HMM-score: 44.5)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 36.5)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 20.8)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 19.2)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 18.8)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 16.1)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 14.6)
    Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 13.7)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 12.9)
    NAD_binding_4; Male sterility protein (PF07993; HMM-score: 12.2)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021841
    • TAT(Tat/SPI): 0.001265
    • LIPO(Sec/SPII): 0.003331
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNILVIGANGGVGSLLVQQLAKENVPFTAGVRQSDQLNALKSQGMKAILVDVENDSIETLTETFKPFDKVIFSVGSGGNTGADKTIIVDLDGAVKSMIASKEANIKHYVMVSTYDSRRQAFDDSGDLKPYTIAKHYADDYLRRSGLNYTILHPGALTNAAGSGKIEAAQYFDGKGEIPREDVATVLKEIVTSNHFNHQEFQIISGEQDIKDALTQFEIEKD

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SA1946 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]