From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2186 [new locus tag: SA_RS12540 ]
  • pan locus tag?: SAUPAN005930000
  • symbol: nasF
  • pan gene symbol?: nasF
  • synonym:
  • product: uroporphyrin-III C-methyl transferase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA2186 [new locus tag: SA_RS12540 ]
  • symbol: nasF
  • product: uroporphyrin-III C-methyl transferase
  • replicon: chromosome
  • strand: -
  • coordinates: 2456711..2457688
  • length: 978
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGTCTGTAGATAAATATGGCAAGGTTTACTTGATAGGTGCGGGACCAGGTAATCCGAAT
    TATTTGACTAAAAAGGCTGAGCGTTTAATACGTGAAGCGGATGTTATACTATATGATCGA
    TTAGTGAATCCGTTAATTTTACAATATGCGAATTTGACTACTGAAATTATCGATGTTGGT
    AAAAAGCCGTATGCAAAACACATTCAGCAAGAAAAAATAAATGAATGTATCGTGGAAGCA
    GCACGTCGATATAACAAGGTTGTGAGGCTTAAAGGTGGCGACCCAGCAATATTTGGACGA
    GTTCAAGAAGAAGTTGACACACTAAACAACTTTAATATTGCGTTTGAAATTGTACCTGGT
    GTGACATCTGCGAGTGCTGCAGTTGCTACGATGCAAACAGGATTAACGATGCGTGCTGTT
    GCTAAGAGTGTGACATTTTCTACAGGTCACTTTAAAGATTCAGAAGAAAATGAAGTAGAT
    GTCAACGCTTTAGTAAATGGTGGTACGTTGGCGATATATATGGGAGTTAAACGTTTAGGG
    AAAATTATCGCCCAGATACAACAGTACACAGATATTGATTATCCGATAGCGATTGTCTTT
    CAAGCATCGTGTTTTAACGAGTTTGTTGTTAAGGGGCGTTTAAGTAATATTGTTGGGAAA
    CTGGAGCATTACGCAATTGAGGCGAAACCAGGTATATGTATTATAGGCGAAGTAGTGGGT
    TATACTGAAAATGTCTCAACAACTTCTAATCCGACTCAGCAATTTTATGTAGTAAGTGGT
    TCTAGACATGACGCCCTTATGCTCTGTGAACATTTATATGACGAAGGTTATGGCTGTTTG
    CTAAACCCAAATGATACATCGAATGGCACATATCATTCGTCGCAATATGATTACTATGAT
    GCATTTATTAAGCAGCAAGAAAATGTAACATATATTTCAACCGATCGTGCAGATGCTAAT
    ACAGTGTTATGTCACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    978

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA2186 [new locus tag: SA_RS12540 ]
  • symbol: NasF
  • description: uroporphyrin-III C-methyl transferase
  • length: 325
  • theoretical pI: 5.64381
  • theoretical MW: 36008.6
  • GRAVY: -0.159385

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin uroporphyrinogen-III C-methyltransferase (TIGR01469; EC 2.1.1.107; HMM-score: 292.4)
    and 5 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-4 C11-methyltransferase (TIGR01465; EC 2.1.1.133; HMM-score: 154.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-3B C17-methyltransferase (TIGR01466; EC 2.1.1.131; HMM-score: 46.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-2 C(20)-methyltransferase (TIGR01467; EC 2.1.1.130; HMM-score: 44.9)
    precorrin-6A synthase (deacetylating) (TIGR02434; EC 2.1.1.152; HMM-score: 40.6)
    precorrin-6y C5,15-methyltransferase (decarboxylating), CbiE subunit (TIGR02467; EC 2.1.1.132; HMM-score: 38.6)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, Pigments Tetrapyrroles CPO analysis  Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
    and 1 more
    Experimental tye  Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
  • PFAM:
    no clan defined TP_methylase; Tetrapyrrole (Corrin/Porphyrin) Methylases (PF00590; HMM-score: 154.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003085
    • TAT(Tat/SPI): 0.000116
    • LIPO(Sec/SPII): 0.000573
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSVDKYGKVYLIGAGPGNPNYLTKKAERLIREADVILYDRLVNPLILQYANLTTEIIDVGKKPYAKHIQQEKINECIVEAARRYNKVVRLKGGDPAIFGRVQEEVDTLNNFNIAFEIVPGVTSASAAVATMQTGLTMRAVAKSVTFSTGHFKDSEENEVDVNALVNGGTLAIYMGVKRLGKIIAQIQQYTDIDYPIAIVFQASCFNEFVVKGRLSNIVGKLEHYAIEAKPGICIIGEVVGYTENVSTTSNPTQQFYVVSGSRHDALMLCEHLYDEGYGCLLNPNDTSNGTYHSSQYDYYDAFIKQQENVTYISTDRADANTVLCH

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: Rex* (repression) regulon, NreC* (activation) regulon
    Rex(TF)important in Energy metabolism; RegPrecise  
    NreC(TF)important in Nitrate and nitrite respiration; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]