Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0038 [new locus tag: SACOL_RS00210 ]
- pan locus tag?: SAUPAN000132000
- symbol: SACOL0038
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0038 [new locus tag: SACOL_RS00210 ]
- symbol: SACOL0038
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 45138..45449
- length: 312
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3237005 NCBI
- RefSeq: YP_184949 NCBI
- BioCyc: see SACOL_RS00210
- MicrobesOnline: 911522 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAACATCAATCGATATATCACAAGAGGCATTAGTGAACACCTATCTCTAGATCTTCAA
ATCTTACTTTGGAACATGGTAAAAGAAAGAGATAATCAACCTGATACAGATTACCTACAC
ATTTTTAGACTGAAAGAAGATGAGAATATACTTTCAATCATACATGAGCAAGAACAACCC
ACGTACAAATTGGAATATCACTATACAAACTATATAAAAAATCAAAATGCATTACCTAAG
AAAGTCTACGTCATCCGAGAAGATGATGTAGATGTTTTTTATTATGTGATGCTTTTACCA
GAAGAATACTAA60
120
180
240
300
312
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0038 [new locus tag: SACOL_RS00210 ]
- symbol: SACOL0038
- description: hypothetical protein
- length: 103
- theoretical pI: 4.71854
- theoretical MW: 12654.3
- GRAVY: -0.623301
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- FIG01107894: hypothetical protein
- PFAM: DUF960 (CL0768) DUF960; Staphylococcal protein of unknown function (DUF960) (PF06124; HMM-score: 84.9)and 4 moreMBB (CL0193) BVU_2266-like; BVU_2266-like (PF22054; HMM-score: 18.5)Calycin (CL0116) MoaF_C; MoaF C-terminal domain (PF17409; HMM-score: 13.6)SH3 (CL0010) Phage_tudor; Phage tudor domain (PF24144; HMM-score: 13.4)no clan defined DUF3103; Protein of unknown function (DUF3103) (PF11301; HMM-score: 12.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.4427
- Cytoplasmic Membrane Score: 0.3187
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.2384
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003815
- TAT(Tat/SPI): 0.000187
- LIPO(Sec/SPII): 0.000943
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNINRYITRGISEHLSLDLQILLWNMVKERDNQPDTDYLHIFRLKEDENILSIIHEQEQPTYKLEYHYTNYIKNQNALPKKVYVIREDDVDVFYYVMLLPEEY
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.