From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0240 [new locus tag: SACOL_RS01215 ]
  • pan locus tag?: SAUPAN001133000
  • symbol: ispD
  • pan gene symbol?: tarI
  • synonym:
  • product: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0240 [new locus tag: SACOL_RS01215 ]
  • symbol: ispD
  • product: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 279162..279878
  • length: 717
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAAATACGCTGGTATTCTAGCTGGAGGTATAGGCTCAAGAATGGGTAACGTACCTTTA
    CCTAAACAATTTTTAGATTTAGACAACAAACCGATTTTAATCCATACATTAGAAAAATTT
    ATTTTAATTAATGATTTTGAAAAAATTATTATCGCGACGCCACAACAATGGATGACGCAT
    ACGAAAGATACACTTAGAAAATTCAAAATTTCTGATGAAAGAATTGAAGTCATTCAAGGT
    GGTAGCGATCGTAACGATACAATTATGAATATCGTTAAACATATTGAATCAACAAATGGT
    ATTAACGATGACGATGTCATTGTGACACATGATGCAGTTAGACCATTTTTAACGCATCGT
    ATTATTAAAGAAAATATTCAAGCTGCTTTAGAGTACGGTGCAGTAGATACAGTGATTGAT
    GCTATAGATACGATTGTTACATCTAAAGATAATCAAACGATTGATGCAATTCCAGTGCGT
    AATGAAATGTACCAAGGTCAAACACCTCAATCGTTTAATATTAATTTATTAAAAGAAAGC
    TATGCACAGTTGAGTGATGAGCAAAAGAGTATTTTATCTGATGCTTGTAAGATTATTGTA
    GAAACAAACAAACCGGTTCGACTTGTAAAAGGTGAGTTATATAACATTAAAGTAACAACA
    CCTTACGATTTAAAAGTAGCGAATGCTATTATTCGAGGTGGTATTGCCGATGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    717

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0240 [new locus tag: SACOL_RS01215 ]
  • symbol: IspD
  • description: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
  • length: 238
  • theoretical pI: 5.36178
  • theoretical MW: 26656.4
  • GRAVY: -0.215546

Function[edit | edit source]

  • reaction:
    EC 2.7.7.40?  ExPASy
    D-ribitol-5-phosphate cytidylyltransferase CTP + D-ribitol 5-phosphate = diphosphate + CDP-ribitol
    EC 2.7.7.60?  ExPASy
    2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase CTP + 2-C-methyl-D-erythritol 4-phosphate = diphosphate + 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (TIGR00453; EC 2.7.7.60; HMM-score: 156.7)
    and 8 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor guanylyltransferase (TIGR02665; EC 2.7.7.77; HMM-score: 19.6)
    molybdenum cofactor cytidylyltransferase (TIGR03310; EC 2.7.7.76; HMM-score: 19.2)
    glucose-1-phosphate thymidylyltransferase (TIGR01208; EC 2.7.7.24; HMM-score: 16.8)
    Hypothetical proteins Conserved TIGR00454 family protein (TIGR00454; HMM-score: 14.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase (TIGR01479; EC 2.7.7.13,5.3.1.8; HMM-score: 14.5)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides glucose-1-phosphate cytidylyltransferase (TIGR02623; EC 2.7.7.33; HMM-score: 14)
    Cell structure Cell envelope Other rare lipoprotein A (TIGR00413; HMM-score: 13.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides glucose-1-phosphate thymidylyltransferase (TIGR01207; EC 2.7.7.24; HMM-score: 13.2)
  • TheSEED:  
    Cell Wall and Capsule Gram-Positive cell wall components Teichoic and lipoteichoic acids biosynthesis  2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
    and 3 more
    ribitol-5-phosphate cytidylyltransferase (EC 2.7.7.40)
    Fatty Acids, Lipids, and Isoprenoids Isoprenoids Isoprenoid Biosynthesis  2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
    Miscellaneous Plant-Prokaryote comparative genomics Competence or DNA damage-inducible protein CinA and related protein families  2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
  • PFAM:
    GT-A (CL0110) IspD; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (PF01128; HMM-score: 145.9)
    and 3 more
    NTP_transf_3; MobA-like NTP transferase domain (PF12804; HMM-score: 31.8)
    CTP_transf_3; Cytidylyltransferase (PF02348; HMM-score: 25)
    NTP_transferase; Nucleotidyl transferase (PF00483; HMM-score: 18.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004137
    • TAT(Tat/SPI): 0.000092
    • LIPO(Sec/SPII): 0.000995
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKYAGILAGGIGSRMGNVPLPKQFLDLDNKPILIHTLEKFILINDFEKIIIATPQQWMTHTKDTLRKFKISDERIEVIQGGSDRNDTIMNIVKHIESTNGINDDDVIVTHDAVRPFLTHRIIKENIQAALEYGAVDTVIDAIDTIVTSKDNQTIDAIPVRNEMYQGQTPQSFNINLLKESYAQLSDEQKSILSDACKIIVETNKPVRLVKGELYNIKVTTPYDLKVANAIIRGGIADD

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5]
    quantitative data / protein copy number per cell: 1407 [6]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 56.28 h [7]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]