From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1102 [new locus tag: SACOL_RS05630 ]
  • pan locus tag?: SAUPAN003317000
  • symbol: pdhA
  • pan gene symbol?: pdhA
  • synonym:
  • product: pyruvate dehydrogenase complex E1 component subunit alpha

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1102 [new locus tag: SACOL_RS05630 ]
  • symbol: pdhA
  • product: pyruvate dehydrogenase complex E1 component subunit alpha
  • replicon: chromosome
  • strand: +
  • coordinates: 1112070..1113182
  • length: 1113
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGCTCCTAAGTTACAAGCCCAATTCGATGCAGTAAAAGTTTTAAATGATACTCAATCG
    AAATTTGAAATGGTTCAAATTTTGGATGAGAATGGTAACGTCGTAAATGAAGACTTAGTA
    CCTGATCTTACGGATGAACAATTAGTGGAATTAATGGAAAGAATGGTATGGACTCGTATC
    CTTGATCAACGTTCTATCTCATTAAACAGACAAGGACGTTTAGGTTTCTATGCACCAACT
    GCTGGTCAAGAAGCATCACAATTAGCGTCACAATACGCTTTAGAAAAAGAAGATTACATT
    TTACCGGGATACAGAGATGTTCCTCAAATTATTTGGCATGGTTTACCATTAACTGAAGCT
    TTCTTATTCTCAAGAGGTCACTTCAAAGGAAATCAATTCCCTGAAGGCGTTAATGCATTA
    AGCCCACAAATTATTATCGGTGCACAATACATTCAAGCTGCTGGTGTTGCATTTGCACTT
    AAAAAACGTGGTAAAAATGCAGTTGCAATCACTTACACTGGTGACGGTGGTTCTTCACAA
    GGTGATTTCTACGAAGGTATTAACTTTGCAGCAGCTTATAAAGCACCTGCAATTTTCGTT
    ATTCAAAACAATAACTATGCAATTTCAACACCAAGAAGCAAGCAAACTGCTGCTGAAACA
    TTAGCTCAAAAAGCAATTGCTGTAGGTATTCCTGGTATCCAAGTTGATGGTATGGATGCG
    TTAGCTGTATATCAAGCAACTAAAGAAGCACGTGACCGCGCAGTTGCAGGTGAAGGTCCA
    ACATTAATTGAAACTATGACATATCGTTATGGTCCTCATACAATGGCTGGTGACGATCCA
    ACTCGTTACAGAACTTCAGACGAAGATGCTGAATGGGAGAAAAAAGACCCATTAGTACGT
    TTCCGTAAATTCCTTGAAAACAAAGGTTTATGGAATGAAGACAAAGAAAATGAAGTTATT
    GAACGTGCAAAAGCTGATATTAAAGCAGCAATTAAAGAGGCTGATAACACTGAAAAACAA
    ACTGTTACTTCTCTAATGGAAATTATGTATGAAGATATGCCTCAAAACTTAGCAGAACAA
    TATGAAATTTACAAAGAGAAGGAGTCGAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1113

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1102 [new locus tag: SACOL_RS05630 ]
  • symbol: PdhA
  • description: pyruvate dehydrogenase complex E1 component subunit alpha
  • length: 370
  • theoretical pI: 4.62739
  • theoretical MW: 41382.3
  • GRAVY: -0.484054

Function[edit | edit source]

  • reaction:
    EC 1.2.4.1?  ExPASy
    Pyruvate dehydrogenase (acetyl-transferring) Pyruvate + [dihydrolipoyllysine-residue acetyltransferase] lipoyllysine = [dihydrolipoyllysine-residue acetyltransferase] S-acetyldihydrolipoyllysine + CO2
  • TIGRFAM:
    Metabolism Energy metabolism Pyruvate dehydrogenase pyruvate dehydrogenase (acetyl-transferring) E1 component, alpha subunit (TIGR03181; EC 1.2.4.1; HMM-score: 488)
    and 5 more
    Metabolism Energy metabolism Pyruvate dehydrogenase pyruvate dehydrogenase (acetyl-transferring) E1 component, alpha subunit (TIGR03182; EC 1.2.4.1; HMM-score: 217.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other 1-deoxy-D-xylulose-5-phosphate synthase (TIGR00204; EC 2.2.1.7; HMM-score: 21.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine 1-deoxy-D-xylulose-5-phosphate synthase (TIGR00204; EC 2.2.1.7; HMM-score: 21.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine 1-deoxy-D-xylulose-5-phosphate synthase (TIGR00204; EC 2.2.1.7; HMM-score: 21.6)
    Metabolism Energy metabolism TCA cycle oxoglutarate dehydrogenase (succinyl-transferring), E1 component (TIGR00239; EC 1.2.4.2; HMM-score: 16.7)
  • TheSEED:  
    Carbohydrates Central carbohydrate metabolism Dehydrogenase complexes  Pyruvate dehydrogenase E1 component alpha subunit (EC 1.2.4.1)
    and 1 more
    Pyruvate metabolism II: acetyl-CoA, acetogenesis from pyruvate  Pyruvate dehydrogenase E1 component alpha subunit (EC 1.2.4.1)
  • PFAM:
    THDP-binding (CL0254) E1_dh; Dehydrogenase E1 component (PF00676; HMM-score: 345.3)
    and 2 more
    DXP_synthase_N; 1-deoxy-D-xylulose-5-phosphate synthase (PF13292; HMM-score: 21.7)
    TPP_enzyme_C; Thiamine pyrophosphate enzyme, C-terminal TPP binding domain (PF02775; HMM-score: 18.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: thiamine diphosphate
  • effectors:
  • protein partners:
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000996
    • TAT(Tat/SPI): 0.00008
    • LIPO(Sec/SPII): 0.000142
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAPKLQAQFDAVKVLNDTQSKFEMVQILDENGNVVNEDLVPDLTDEQLVELMERMVWTRILDQRSISLNRQGRLGFYAPTAGQEASQLASQYALEKEDYILPGYRDVPQIIWHGLPLTEAFLFSRGHFKGNQFPEGVNALSPQIIIGAQYIQAAGVAFALKKRGKNAVAITYTGDGGSSQGDFYEGINFAAAYKAPAIFVIQNNNYAISTPRSKQTAAETLAQKAIAVGIPGIQVDGMDALAVYQATKEARDRAVAGEGPTLIETMTYRYGPHTMAGDDPTRYRTSDEDAEWEKKDPLVRFRKFLENKGLWNEDKENEVIERAKADIKAAIKEADNTEKQTVTSLMEIMYEDMPQNLAEQYEIYKEKESK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5] [6]
    quantitative data / protein copy number per cell: 6109 [7]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 20.57 h [8]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Annette Dreisbach, Kristina Hempel, Girbe Buist, Michael Hecker, Dörte Becher, Jan Maarten van Dijl
    Profiling the surfacome of Staphylococcus aureus.
    Proteomics: 2010, 10(17);3082-96
    [PubMed:20662103] [WorldCat.org] [DOI] (I p)
  5. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  6. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  7. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  8. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]