From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0883 [new locus tag: SACOL_RS04535 ]
  • pan locus tag?: SAUPAN002839000
  • symbol: SACOL0883
  • pan gene symbol?: metP1
  • synonym:
  • product: ABC transporter permease

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0883 [new locus tag: SACOL_RS04535 ]
  • symbol: SACOL0883
  • product: ABC transporter permease
  • replicon: chromosome
  • strand: +
  • coordinates: 901814..902509
  • length: 696
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGGTAAATCATTTAGTGAAATTATAAATGAAATGATTACAATGCCTAATATTCAGTGG
    CCAGAAGTTTGGACTGCAATAGTCGAAACACTATACATGACAGTCGTCTCAACTATATTT
    GCATTTATACTTGGTCTTATTTTAGGTGTGTTATTATTCTTGTCTGCTAAAGGTAAGTCT
    ATCGGTGCAAGGTTATTTTATTCTATCGTTTCTTTCATTGTTAACTTATTTAGAGCGATA
    CCATTTATTATTTTAATTTTATTATTAATTCCATTTACAAGTTTGATACTTGGAACGATA
    AGTGGTCCGACAGGTGCGTTACCAGCCTTGATCATTGGCGCAGCACCGTTTTATGCAAGG
    CTCGTAGAAATTGCTTTTAAAGAAATTGATAAAGGTGTCATCGAAGCGGCTTGGTCAATG
    GGCGCTAATACTTGGACAGTAATTCGTAAAGTCCTTTTACCTGAAGCTATGCCAGCGCTA
    GTGTCTGGCATTACAGTTACAGCAATCGCTTTAGTTGGTTCAACAGCAGTTGCAGGTGTA
    ATTGGTGCCGGTGGTTTAGGAAATTTAGCATACTTAACAGGTTTCACTCGAAATCAAAAT
    GATGTCATTTTAGTATCAACAGTTTTTATTTTAATTATTGTATTTATAATCCAATTCATT
    GGGGATTGGCTTACAAATAAACTTGATAAACGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    696


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0883 [new locus tag: SACOL_RS04535 ]
  • symbol: SACOL0883
  • description: ABC transporter permease
  • length: 231
  • theoretical pI: 9.46842
  • theoretical MW: 24890.7
  • GRAVY: 1.0697

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, permease protein PhnE (TIGR01097; HMM-score: 86.7)
    and 16 more
    choline ABC transporter, permease protein (TIGR03416; HMM-score: 53.2)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, permease protein PstA (TIGR00974; HMM-score: 48.6)
    2-aminoethylphosphonate ABC transporter, permease protein (TIGR03226; HMM-score: 37.4)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, permease protein CysT (TIGR02139; HMM-score: 37.2)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, permease protein (TIGR00969; HMM-score: 35.9)
    2-aminoethylphosphonate ABC transport system, membrane component PhnV (TIGR03255; HMM-score: 32)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, permease protein (TIGR02141; HMM-score: 28.9)
    ectoine/hydroxyectoine ABC transporter, permease protein EhuD (TIGR03003; HMM-score: 26.9)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, permease protein PstC (TIGR02138; HMM-score: 26.6)
    ectoine/hydroxyectoine ABC transporter, permease protein EhuC (TIGR03004; HMM-score: 24.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines amino ABC transporter, permease protein, 3-TM region, His/Glu/Gln/Arg/opine family (TIGR01726; HMM-score: 23.9)
    NifC-like ABC-type porter (TIGR01581; HMM-score: 21.2)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, permease protein CysW (TIGR02140; HMM-score: 14.2)
    Metabolism Energy metabolism Electron transport cytochrome aa3 quinol oxidase, subunit II (TIGR01432; EC 1.10.3.-; HMM-score: 9.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, permease protein (TIGR03262; HMM-score: 7.5)
    Metabolism Energy metabolism Electron transport caa(3)-type oxidase, subunit IV (TIGR02229; HMM-score: 7)
  • TheSEED  :
    • Methionine ABC transporter, permease protein MetI
    Amino Acids and Derivatives Lysine, threonine, methionine, and cysteine Methionine Biosynthesis  Methionine ABC transporter permease protein
    and 1 more
    Amino Acids and Derivatives Lysine, threonine, methionine, and cysteine Methionine Degradation  Methionine ABC transporter permease protein
  • PFAM:
    BPD_transp_1 (CL0404) BPD_transp_1; Binding-protein-dependent transport system inner membrane component (PF00528; HMM-score: 75.6)
    and 2 more
    no clan defined TEX13B_C; Testis-expressed protein 13B, C-terminal (PF22836; HMM-score: 10.9)
    DUF6773; Family of unknown function (DUF6773) (PF20563; HMM-score: 7.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 1
    • Cell wall & surface Score: 0
    • Extracellular Score: 0
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.009004
    • TAT(Tat/SPI): 0.000133
    • LIPO(Sec/SPII): 0.001426
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MGKSFSEIINEMITMPNIQWPEVWTAIVETLYMTVVSTIFAFILGLILGVLLFLSAKGKSIGARLFYSIVSFIVNLFRAIPFIILILLLIPFTSLILGTISGPTGALPALIIGAAPFYARLVEIAFKEIDKGVIEAAWSMGANTWTVIRKVLLPEAMPALVSGITVTAIALVGSTAVAGVIGAGGLGNLAYLTGFTRNQNDVILVSTVFILIIVFIIQFIGDWLTNKLDKR

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization: Integral membrane [1] [2]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: S-box (transcription termination) regulon
    S-box(RNA)important in Methionine biosynthesis; transcription unit transferred from N315 data RegPrecise 

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]